{"title":"Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.","authors":"Runnan Zhou, Sihui Wang, Jianwei Li, Mingliang Yang, Chunyan Liu, Zhaoming Qi, Chang Xu, Xiaoxia Wu, Qingshan Chen, Ying Zhao","doi":"10.1111/pce.15250","DOIUrl":null,"url":null,"abstract":"<p><p>Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.</p>","PeriodicalId":222,"journal":{"name":"Plant, Cell & Environment","volume":" ","pages":""},"PeriodicalIF":6.0000,"publicationDate":"2024-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":"0","resultStr":null,"platform":"Semanticscholar","paperid":null,"PeriodicalName":"Plant, Cell & Environment","FirstCategoryId":"2","ListUrlMain":"https://doi.org/10.1111/pce.15250","RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":null,"EPubDate":"","PubModel":"","JCR":"Q1","JCRName":"PLANT SCIENCES","Score":null,"Total":0}
引用次数: 0
Abstract
Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.
期刊介绍:
Plant, Cell & Environment is a premier plant science journal, offering valuable insights into plant responses to their environment. Committed to publishing high-quality theoretical and experimental research, the journal covers a broad spectrum of factors, spanning from molecular to community levels. Researchers exploring various aspects of plant biology, physiology, and ecology contribute to the journal's comprehensive understanding of plant-environment interactions.