Jin Xu, Nan Sang, Junning Zhao, Wei He, Nannan Zhang, Xueliang Li
{"title":"[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis.","authors":"Jin Xu, Nan Sang, Junning Zhao, Wei He, Nannan Zhang, Xueliang Li","doi":"10.3892/mmr.2024.13307","DOIUrl":null,"url":null,"abstract":"<p><p>Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of <i>Molecular Medicine Reports</i> for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.5000,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11350621/pdf/","citationCount":"0","resultStr":null,"platform":"Semanticscholar","paperid":null,"PeriodicalName":"Molecular medicine reports","FirstCategoryId":"3","ListUrlMain":"https://doi.org/10.3892/mmr.2024.13307","RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":null,"EPubDate":"2024/8/19 0:00:00","PubModel":"Epub","JCR":"Q2","JCRName":"MEDICINE, RESEARCH & EXPERIMENTAL","Score":null,"Total":0}
引用次数: 0
Abstract
Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].
期刊介绍:
Molecular Medicine Reports is a monthly, peer-reviewed journal available in print and online, that includes studies devoted to molecular medicine, underscoring aspects including pharmacology, pathology, genetics, neurosciences, infectious diseases, molecular cardiology and molecular surgery. In vitro and in vivo studies of experimental model systems pertaining to the mechanisms of a variety of diseases offer researchers the necessary tools and knowledge with which to aid the diagnosis and treatment of human diseases.