{"title":"为开发高性能生物传感器建立环丙沙星特异性适配体的硅学模型","authors":"Misgana Mengistu Asmare , Chandran Krishnaraj , Sivaprakasam Radhakrishnan , Byoung-Sukh Kim , June-Sun Yoon , Soon-Il Yun","doi":"10.1016/j.jmgm.2024.108787","DOIUrl":null,"url":null,"abstract":"<div><p>Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10<sup>−9</sup> – 200 × 10<sup>−9</sup> M), detection limit (1.0 × 10<sup>−9</sup> M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":"130 ","pages":"Article 108787"},"PeriodicalIF":3.0000,"publicationDate":"2024-07-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":"0","resultStr":"{\"title\":\"In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor\",\"authors\":\"Misgana Mengistu Asmare , Chandran Krishnaraj , Sivaprakasam Radhakrishnan , Byoung-Sukh Kim , June-Sun Yoon , Soon-Il Yun\",\"doi\":\"10.1016/j.jmgm.2024.108787\",\"DOIUrl\":null,\"url\":null,\"abstract\":\"<div><p>Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10<sup>−9</sup> – 200 × 10<sup>−9</sup> M), detection limit (1.0 × 10<sup>−9</sup> M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.</p></div>\",\"PeriodicalId\":16361,\"journal\":{\"name\":\"Journal of molecular graphics & modelling\",\"volume\":\"130 \",\"pages\":\"Article 108787\"},\"PeriodicalIF\":3.0000,\"publicationDate\":\"2024-07-01\",\"publicationTypes\":\"Journal Article\",\"fieldsOfStudy\":null,\"isOpenAccess\":false,\"openAccessPdf\":\"\",\"citationCount\":\"0\",\"resultStr\":null,\"platform\":\"Semanticscholar\",\"paperid\":null,\"PeriodicalName\":\"Journal of molecular graphics & modelling\",\"FirstCategoryId\":\"99\",\"ListUrlMain\":\"https://www.sciencedirect.com/science/article/pii/S1093326324000871\",\"RegionNum\":4,\"RegionCategory\":\"生物学\",\"ArticlePicture\":[],\"TitleCN\":null,\"AbstractTextCN\":null,\"PMCID\":null,\"EPubDate\":\"2024/5/5 0:00:00\",\"PubModel\":\"Epub\",\"JCR\":\"Q2\",\"JCRName\":\"BIOCHEMICAL RESEARCH METHODS\",\"Score\":null,\"Total\":0}","platform":"Semanticscholar","paperid":null,"PeriodicalName":"Journal of molecular graphics & modelling","FirstCategoryId":"99","ListUrlMain":"https://www.sciencedirect.com/science/article/pii/S1093326324000871","RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":null,"EPubDate":"2024/5/5 0:00:00","PubModel":"Epub","JCR":"Q2","JCRName":"BIOCHEMICAL RESEARCH METHODS","Score":null,"Total":0}
In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor
Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10−9 – 200 × 10−9 M), detection limit (1.0 × 10−9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.
期刊介绍:
The Journal of Molecular Graphics and Modelling is devoted to the publication of papers on the uses of computers in theoretical investigations of molecular structure, function, interaction, and design. The scope of the journal includes all aspects of molecular modeling and computational chemistry, including, for instance, the study of molecular shape and properties, molecular simulations, protein and polymer engineering, drug design, materials design, structure-activity and structure-property relationships, database mining, and compound library design.
As a primary research journal, JMGM seeks to bring new knowledge to the attention of our readers. As such, submissions to the journal need to not only report results, but must draw conclusions and explore implications of the work presented. Authors are strongly encouraged to bear this in mind when preparing manuscripts. Routine applications of standard modelling approaches, providing only very limited new scientific insight, will not meet our criteria for publication. Reproducibility of reported calculations is an important issue. Wherever possible, we urge authors to enhance their papers with Supplementary Data, for example, in QSAR studies machine-readable versions of molecular datasets or in the development of new force-field parameters versions of the topology and force field parameter files. Routine applications of existing methods that do not lead to genuinely new insight will not be considered.