{"title":"法国首例紫丁香感染女贞叶斑病相关病毒(PLBaV)的报道。","authors":"Chantal Faure, Armelle Marais, Thierry Candresse","doi":"10.1094/PDIS-12-24-2696-PDN","DOIUrl":null,"url":null,"abstract":"<p><p>Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the association between PLBaV and this family. Since no other viral agent was identified in the HTS analysis, the chlorotic ringspot symptoms that prompted this investigation were most likely caused by PLBaV. The affected plant has since died but whether the initial poor growth and later death were caused by PLBaV is not known as these symptoms might have had another cause. Raspberry bushy dwarf virus (RBDV) the best known Idaeovirus is transmitted by pollen and seed (Isogai et al., 2014), raising the question of whether PLBaV might be similarly transmitted in its various hosts. The rarity of PLBaV reports since its discovery in 2017 suggest it should be of low concern but data is needed to better evaluate its presence in and pathogenicity to lilac.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4000,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":"0","resultStr":"{\"title\":\"First report of privet leaf blotch-associated virus (PLBaV) infecting lilac (<i>Syringa vulgaris</i> L.) in France.\",\"authors\":\"Chantal Faure, Armelle Marais, Thierry Candresse\",\"doi\":\"10.1094/PDIS-12-24-2696-PDN\",\"DOIUrl\":null,\"url\":null,\"abstract\":\"<p><p>Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the association between PLBaV and this family. Since no other viral agent was identified in the HTS analysis, the chlorotic ringspot symptoms that prompted this investigation were most likely caused by PLBaV. The affected plant has since died but whether the initial poor growth and later death were caused by PLBaV is not known as these symptoms might have had another cause. Raspberry bushy dwarf virus (RBDV) the best known Idaeovirus is transmitted by pollen and seed (Isogai et al., 2014), raising the question of whether PLBaV might be similarly transmitted in its various hosts. The rarity of PLBaV reports since its discovery in 2017 suggest it should be of low concern but data is needed to better evaluate its presence in and pathogenicity to lilac.</p>\",\"PeriodicalId\":20063,\"journal\":{\"name\":\"Plant disease\",\"volume\":\" \",\"pages\":\"\"},\"PeriodicalIF\":4.4000,\"publicationDate\":\"2025-01-28\",\"publicationTypes\":\"Journal Article\",\"fieldsOfStudy\":null,\"isOpenAccess\":false,\"openAccessPdf\":\"\",\"citationCount\":\"0\",\"resultStr\":null,\"platform\":\"Semanticscholar\",\"paperid\":null,\"PeriodicalName\":\"Plant disease\",\"FirstCategoryId\":\"97\",\"ListUrlMain\":\"https://doi.org/10.1094/PDIS-12-24-2696-PDN\",\"RegionNum\":2,\"RegionCategory\":\"农林科学\",\"ArticlePicture\":[],\"TitleCN\":null,\"AbstractTextCN\":null,\"PMCID\":null,\"EPubDate\":\"\",\"PubModel\":\"\",\"JCR\":\"Q1\",\"JCRName\":\"PLANT SCIENCES\",\"Score\":null,\"Total\":0}","platform":"Semanticscholar","paperid":null,"PeriodicalName":"Plant disease","FirstCategoryId":"97","ListUrlMain":"https://doi.org/10.1094/PDIS-12-24-2696-PDN","RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":null,"EPubDate":"","PubModel":"","JCR":"Q1","JCRName":"PLANT SCIENCES","Score":null,"Total":0}
First report of privet leaf blotch-associated virus (PLBaV) infecting lilac (Syringa vulgaris L.) in France.
Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the association between PLBaV and this family. Since no other viral agent was identified in the HTS analysis, the chlorotic ringspot symptoms that prompted this investigation were most likely caused by PLBaV. The affected plant has since died but whether the initial poor growth and later death were caused by PLBaV is not known as these symptoms might have had another cause. Raspberry bushy dwarf virus (RBDV) the best known Idaeovirus is transmitted by pollen and seed (Isogai et al., 2014), raising the question of whether PLBaV might be similarly transmitted in its various hosts. The rarity of PLBaV reports since its discovery in 2017 suggest it should be of low concern but data is needed to better evaluate its presence in and pathogenicity to lilac.
期刊介绍:
Plant Disease is the leading international journal for rapid reporting of research on new, emerging, and established plant diseases. The journal publishes papers that describe basic and applied research focusing on practical aspects of disease diagnosis, development, and management.