{"title":"Correction to “The Oncolytic Virus H101 Combined with Gnaq Sirna-Mediated Knockdown Reduces Uveal Melanoma Cell Viability”","authors":"","doi":"10.1002/jcb.30648","DOIUrl":null,"url":null,"abstract":"<p>Li Y, He J, Qiu C, et al. The oncolytic virus H101 combined with GNAQ siRNA-mediated knockdown reduces uveal melanoma cell viability. <i>J Cell Biochem</i>. 2019;120:5766-5776. https://doi.org/10.1002/jcb.27863.</p><p>In the original version of this article, the authors mistakenly duplicated panels in Figure 2A showing the morphological changes of OMM2.3 cells treated with “H101” and “H101+siNC,” as well as in Figure 3A, showing the flow cytometric analysis of OMM2.3 cells in the “NC” and “siGNAQ” groups. In the corrected Figures 2A and 3A below, the authors have replaced the duplicated “H101+siNC” and “siGNAQ” panels with the correct ones, respectively. Additionally, in the correct Figure 3 below, the axis labels have been corrected from “PMT4 Log” to “PI” (Propidium Iodide) and from “PMT2 Log” to “Annexin V-FITC”.</p><p>The legend for Figure 3 is corrected as per below (changes in bold):</p><p><b>Figure</b> 3. Apoptosis was modulated by cotreatment with H101 and siGNAQ. A, Apoptosis of the OMM2.3, 92.1, and OCM1 cell lines was detected with an annexin-V kit and a flow-cytometric analysis. B, At 48 h after transfection, the proportion of <b>early apoptotic cells</b> (<b>Annexin V</b><sup><b>+</b></sup> <b>PI</b><sup><b>-</b></sup>) <b>was calculated</b>. When H101 was combined with siGNAQ, the apoptosis of UM cells was enhanced relative to that induced by H101 alone. The results are presented as the means and standard error of the mean; *<i>P</i> < 0.05. UM, uveal melanoma.</p><p>Additionally, there is a typographical error in the sequence of the reverse primer for GADPH amplification. The correct sequence is “CAAAGTTGTCATGGATGACC”.</p><p>Finally, the author omitted to mention that the bands for GNAQ and β-actin in Figure 5A are referenced from Figure 1C.</p><p>The authors apologize for these mistakes and for any inconvenience these may have caused.</p>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"125 10","pages":""},"PeriodicalIF":2.8000,"publicationDate":"2024-09-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://onlinelibrary.wiley.com/doi/epdf/10.1002/jcb.30648","citationCount":"0","resultStr":null,"platform":"Semanticscholar","paperid":null,"PeriodicalName":"Journal of cellular biochemistry","FirstCategoryId":"99","ListUrlMain":"https://onlinelibrary.wiley.com/doi/10.1002/jcb.30648","RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":null,"EPubDate":"","PubModel":"","JCR":"Q3","JCRName":"BIOCHEMISTRY & MOLECULAR BIOLOGY","Score":null,"Total":0}
引用次数: 0
Abstract
Li Y, He J, Qiu C, et al. The oncolytic virus H101 combined with GNAQ siRNA-mediated knockdown reduces uveal melanoma cell viability. J Cell Biochem. 2019;120:5766-5776. https://doi.org/10.1002/jcb.27863.
In the original version of this article, the authors mistakenly duplicated panels in Figure 2A showing the morphological changes of OMM2.3 cells treated with “H101” and “H101+siNC,” as well as in Figure 3A, showing the flow cytometric analysis of OMM2.3 cells in the “NC” and “siGNAQ” groups. In the corrected Figures 2A and 3A below, the authors have replaced the duplicated “H101+siNC” and “siGNAQ” panels with the correct ones, respectively. Additionally, in the correct Figure 3 below, the axis labels have been corrected from “PMT4 Log” to “PI” (Propidium Iodide) and from “PMT2 Log” to “Annexin V-FITC”.
The legend for Figure 3 is corrected as per below (changes in bold):
Figure 3. Apoptosis was modulated by cotreatment with H101 and siGNAQ. A, Apoptosis of the OMM2.3, 92.1, and OCM1 cell lines was detected with an annexin-V kit and a flow-cytometric analysis. B, At 48 h after transfection, the proportion of early apoptotic cells (Annexin V+PI-) was calculated. When H101 was combined with siGNAQ, the apoptosis of UM cells was enhanced relative to that induced by H101 alone. The results are presented as the means and standard error of the mean; *P < 0.05. UM, uveal melanoma.
Additionally, there is a typographical error in the sequence of the reverse primer for GADPH amplification. The correct sequence is “CAAAGTTGTCATGGATGACC”.
Finally, the author omitted to mention that the bands for GNAQ and β-actin in Figure 5A are referenced from Figure 1C.
The authors apologize for these mistakes and for any inconvenience these may have caused.
期刊介绍:
The Journal of Cellular Biochemistry publishes descriptions of original research in which complex cellular, pathogenic, clinical, or animal model systems are studied by biochemical, molecular, genetic, epigenetic or quantitative ultrastructural approaches. Submission of papers reporting genomic, proteomic, bioinformatics and systems biology approaches to identify and characterize parameters of biological control in a cellular context are encouraged. The areas covered include, but are not restricted to, conditions, agents, regulatory networks, or differentiation states that influence structure, cell cycle & growth control, structure-function relationships.