DACT1 variants and colorectal cancer.

Abstract

According to GLOBOCAN, colorectal cancer is the third most frequent cancer and the second most common cause of cancer death worldwide [1]. Several risk factors, such as advanced age, family history of cancer, sex, alcohol, red meat, genetic, and epigenetic, mainly contribute to CRC prevalence [2]. Wnt/β-catenin is one of the most common pathways activated in many cancers and plays a key role in cell proliferation, apoptosis, Ca homoeostasis, and differentiation [3]. The aberrant activation of the Wnt/β-catenin pathway is responsible for more than 90% of colorectal cancer cases [4]. The DACT family proteins (Dapper Antagonist of Catenin) consist of three members: DACT1, DACT2, and DACT3 [5]. DACT1 (also known as Dapper1/Dpr1) negatively regulates the Wnt/β-catenin pathway by interacting with Dishevelled (Dvl), a key mediator of Wnt signalling, and promoting its lysosomal degradation; therefore, DACT1 can act as a potential tumour-suppressor gene [6]. Given the role of DACT1 in Wnt pathway regulation and colorectal cancer pathogenesis, it is possible the DACT1 single nucleotide polymorphisms (SNPs) may contribute to the risk of developing colorectal cancer. Huang et al. have shown that different genotypes of rs863091 affect the expression of DACT1 in gastric cancer [7]. However, the association of genetic variations in the DACT1 with colorectal cancer is unknown. We therefore hypothesized links between DACT1 rs863091 and rs11541 SNPs with colorectal cancer. We tested our hypothesis with 221 cases of colorectal cancer (118 males and 103 females, mean/SD age 49.5 ± 12.2) and 186 cancer-free controls (82 males and 104 females, 48.4 ± 12.9: sex and age differences p = 0.061 and p = 0.406, respectively). All subjects were selected from referrals to Taleghani Hospital, Tehran, Iran, between 2006 and 2015. All patients were diagnosed and confirmed based on histopathological tests, clinical examination, and colonoscopy on isolated biopsies. Noncancerous individuals were randomly taken from the people who visited the hospital for a routine check-up with no malignancy. Patients with a history of malignancies (self-reported history), radiotherapy, and previous chemotherapy treatment were excluded. The Ethics Committee of Shahid Beheshti University of Medical Sciences approved the current research) Code: IR. SBMU. MSP.REC.1397.632. All cases and controls in this project provided written informed consent. The genotype data for DACT1 rs863091 and rs11541 was obtained according to UCSC Genome Browser (https://genome.ucsc.edu/) and dbSNP (https://www. ncbi.nlm.nih.gov/projects/) databases. The DACT1 rs863091 and rs11541 variants are located in the coding exon 4 and 3-UTR of the DACT1 gene, respectively. We used several online databases, such as HaploReg v4.1 (https://pubs.broadinstitute.org/mammals/haploreg/hap loreg.php) and mirSNP (http://bioinfo.bjmu.edu.cn/ mirsnp/search/), to predict the potential functional characteristics of these SNPs. Five 5 ml peripheral blood was collected into EDTA. We used the salting-out method for genomic DNA extraction, then extracted DNA was stored at –20°C. The quality of DNA was evaluated by 1% agarose gel electrophoresis prepared in 0.5X TBE buffer (tris/ borate/EDTA). The purity and concentration of the extracted DNA were measured by NanoDrop Spectropho tometer (Aosheng, China). DACT1 rs863091 and rs11541 genotyping were performed by tetra-primer amplification refractory mutation system polymerase chain reaction (TP-ARMS-PCR) method. Primer1 online software (http://primer1.soton.ac.uk/primer1.html) was employed for designing primers. The primer sequences for genotyping rs863091 were: Forward inner (Fi) GGCTTCTGAGGA ACGGGAGCGTTTGTTTC, Reverse inner (Ri) CCTGTGAGA CACCGCCCGGGGCTATA, Forward Outer (Fo) GCGGTGGA TCTGAGCTAGATGCCGTCAA, Reverse Outer (Ro) CCTCTT GCTTTCGGCTTGTTCGGCCTTT. The primer sequences for genotyping rs11541 were: Fi: TCTTAAAAAACAGCCC TTCCACAAAC, Ri: AATCCAGTCCAGATTGGACCTTTGAA CC, Fo: CTACTCATGCACAAAACATGCATATATTGG, Ro: AGTTTTGGGATAAAATTTTGGTCCTTGG. PCR reactions were prepared in a 25 μl reaction volume, including 2 μl of genomic DNA with DNA concentration of 100–200 ng,