The JAK2 V617F mutation in breast cancer?

Abstract

Dear Editor, In regards to few queries raised by Mr. Stephen, elaborate tech‐ nical details regarding primer sequence (available) and protocol de‐ tails were provided in the Original work submitted but as it is to be published as a “ Correspondence” those details could not be included because of lack of space. However, validated and robust procedures were followed in the PCR protocol covering all facets of quality control. Just for info purpose, the details are shared. “PCR Amplification Real‐time Polymerase chain reaction was used for amplifica‐ tion of DNA and was carried out in Thermal cycler Rotor‐Gene‐Q (Corbett Research) having quality of rapidly heating and cooling of samples. The following primers and TaqManTM probe were used: Forward: 5′‐AGCATTTGGTTTTAAATTATGGAGTATaTT‐3′ Reverse: 5′‐CAAAAACAGATGCTCTGAGAAAGG‐3′ TaqMan Probe: 5′‐FAM‐CTCCACAGAAACATACTC‐3′ DNA amplification was carried out in 20 microliter reaction mix‐ ture containing 5 pM of each primer along with probe (IDT), 0.5 units of Taq polymerase (Thermo Fisher Scientific), 30 mmol/L of each dNTP, 10 mmol/L Tris Hydrochloric acid (pH 8.3), 50 mmol/L potas‐ sium chloride, 1.5 mmol/L MgCl2, 100 mg/mL gelatin, and 0.1‐0.3 μg of genomic DNA (2 μL of extracted DNA).RT‐PCR was done on Rotor‐Gene‐Q (Corbett Research). Thirty cycles were performed. It included initial denaturation of DNA at 95°C for two minutes that allowed the separation of nucleic acids, followed by annealing at 60°C for 1 minute that allowed the primer binding to DNA template. Fluorescence was then measured during short temperature phase (few seconds) at 60°C. The results of RT‐PCR were recorded as cycle threshold (Ct) and Ct < 20 was taken as positive and rest was taken as negative. Positive and negative control DNA samples for JAK 2 V617F mutations were included in all batches. Positive samples were further tested for additional mutations that affect signaling path‐ way notably JAK2 exon12, STAT, KRAS, NRAS, CBL1, PTPN11, RAF, MAP, MYC, and PI3K mutations by Sanger sequencing. JAK2 Exon 14 positive DNA of an age matched MPN negative TNBC patient was taken as positive control while Exon 14 negative DNA of an age matched MPN negative TNBC patient was taken as negative control for PCR. To check the robustness of JAK2‐V617F Exon 14 mutation assays, quantitative results performed were found to be reliable across all mutation loads with moderate variability at low Allele burden (0.1 and 1%; CV = 0.45 and 0.76, respectively). Sanger sequencing As already mentioned all the positive and negative samples for JAK2 exon14 mutation of TNBC were tested for additional mutations by Sanger sequencing. It was performed on the same amplicons as used for Real‐time PCR. The segments were purified by a QIA quick Purification Kit (Qiagen). The purified products were then sequenced on both strands using the PCR primers and the PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Bio‐system) in an automated sequencer (ABI 3130, Applied Biosystems). Forward and reverse chromatograms were aligned and compared using the Mutation Surveyor 3.01 software (Softgenetics).” This is first kind of study in Pakistan, obviously because of re‐ source constraints we could not use modalities like Next Generation Sequencing, but this should “not” undermine the efforts put up by our team. Having a background experience of more than thirty years, our team of clinical hematologists can safely pick up cases of JAk2 muta‐ tion in MPNs using all standard protocols required. We did not find any MPNs in our JAK2 positive cases. The diseases pattern of this disease could be different in our part of the world in comparison with the Western world, and by judging the disease burden of JAK2 positive cases in Pakistan, it is “absolutely judicious” to go for screening in our part of the world.