Abdul Rohman, Hazza' Hammam Nawwaruddin, M A Motalib Hossain, Marlyn Dian Laksitorini, Dwi Lestari
{"title":"开发用于分析牛肉丸中老鼠肉(Bandicota bengalensis)的实时聚合酶链反应,以进行清真认证。","authors":"Abdul Rohman, Hazza' Hammam Nawwaruddin, M A Motalib Hossain, Marlyn Dian Laksitorini, Dwi Lestari","doi":"10.5455/OVJ.2024.v14.i9.37","DOIUrl":null,"url":null,"abstract":"<p><strong>Background: </strong>Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).</p><p><strong>Aim: </strong>This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.</p><p><strong>Methods: </strong>This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.</p><p><strong>Results: </strong>The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3<sup>o</sup>C over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (<i>R</i> <sup>2</sup>) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.</p><p><strong>Conclusion: </strong>The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.</p>","PeriodicalId":19531,"journal":{"name":"Open Veterinary Journal","volume":"14 9","pages":"2484-2492"},"PeriodicalIF":1.0000,"publicationDate":"2024-09-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11563617/pdf/","citationCount":"0","resultStr":"{\"title\":\"Development of real-time polymerase chain reaction for analysis of rat meat (<i>Bandicota bengalensis</i>) in beef meatballs for halal authentication.\",\"authors\":\"Abdul Rohman, Hazza' Hammam Nawwaruddin, M A Motalib Hossain, Marlyn Dian Laksitorini, Dwi Lestari\",\"doi\":\"10.5455/OVJ.2024.v14.i9.37\",\"DOIUrl\":null,\"url\":null,\"abstract\":\"<p><strong>Background: </strong>Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).</p><p><strong>Aim: </strong>This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.</p><p><strong>Methods: </strong>This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.</p><p><strong>Results: </strong>The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3<sup>o</sup>C over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (<i>R</i> <sup>2</sup>) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.</p><p><strong>Conclusion: </strong>The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.</p>\",\"PeriodicalId\":19531,\"journal\":{\"name\":\"Open Veterinary Journal\",\"volume\":\"14 9\",\"pages\":\"2484-2492\"},\"PeriodicalIF\":1.0000,\"publicationDate\":\"2024-09-01\",\"publicationTypes\":\"Journal Article\",\"fieldsOfStudy\":null,\"isOpenAccess\":false,\"openAccessPdf\":\"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11563617/pdf/\",\"citationCount\":\"0\",\"resultStr\":null,\"platform\":\"Semanticscholar\",\"paperid\":null,\"PeriodicalName\":\"Open Veterinary Journal\",\"FirstCategoryId\":\"1085\",\"ListUrlMain\":\"https://doi.org/10.5455/OVJ.2024.v14.i9.37\",\"RegionNum\":0,\"RegionCategory\":null,\"ArticlePicture\":[],\"TitleCN\":null,\"AbstractTextCN\":null,\"PMCID\":null,\"EPubDate\":\"2024/9/30 0:00:00\",\"PubModel\":\"Epub\",\"JCR\":\"Q3\",\"JCRName\":\"VETERINARY SCIENCES\",\"Score\":null,\"Total\":0}","platform":"Semanticscholar","paperid":null,"PeriodicalName":"Open Veterinary Journal","FirstCategoryId":"1085","ListUrlMain":"https://doi.org/10.5455/OVJ.2024.v14.i9.37","RegionNum":0,"RegionCategory":null,"ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":null,"EPubDate":"2024/9/30 0:00:00","PubModel":"Epub","JCR":"Q3","JCRName":"VETERINARY SCIENCES","Score":null,"Total":0}
Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication.
Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).
Aim: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.
期刊介绍:
Open Veterinary Journal is a peer-reviewed international open access online and printed journal that publishes high-quality original research articles. reviews, short communications and case reports dedicated to all aspects of veterinary sciences and its related subjects. Research areas include the following: Infectious diseases of zoonotic/food-borne importance, applied biochemistry, parasitology, endocrinology, microbiology, immunology, pathology, pharmacology, physiology, epidemiology, molecular biology, immunogenetics, surgery, ophthalmology, dermatology, oncology and animal reproduction. All papers are peer-reviewed. Moreover, with the presence of well-qualified group of international referees, the process of publication will be done meticulously and to the highest standards.