{"title":"Brachyury蛋白:一个t结构域转录因子","authors":"Andreas Kispert","doi":"10.1016/S1044-5781(06)80003-4","DOIUrl":null,"url":null,"abstract":"<div><p>The molecular genetic analysis of the development of vertebrate and invertebrate model organisms has identified many developmental control genes which are highly conserved during evolution. An important role in the control of developmental decisions is executed by transcription factors, proteins which regulate the transcription of target genes, either as activators or repressors. In-vitro analyses have revealed that the protein product of the mouse <em>Brachyury (T)</em> gene, which is required in the differentiation of the notochord and the formation of posterior mesoderm, encodes a transcription factor with a novel DNA binding domain, the T domain. This unusually large DNA binding domain recognizes specifically the palindromic target sequence TTTCACACCTAGGTGTGAAA which was identified in an in-vitro binding site selection procedure. Upon binding to the palindromic target sequence, T protein activates transcription of a reporter gene. The DNA binding domain in the N-terminal half of the protein is physically separated from the domains in the C-terminal half which confer transcriptional modulation function. The T protein is the prototypical member of a growing class of molecules which share this conserved T domain.</p></div>","PeriodicalId":101155,"journal":{"name":"Seminars in Developmental Biology","volume":"6 6","pages":"Pages 395-403"},"PeriodicalIF":0.0000,"publicationDate":"1995-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1016/S1044-5781(06)80003-4","citationCount":"26","resultStr":"{\"title\":\"The Brachyury protein: A T-domain transcription factor\",\"authors\":\"Andreas Kispert\",\"doi\":\"10.1016/S1044-5781(06)80003-4\",\"DOIUrl\":null,\"url\":null,\"abstract\":\"<div><p>The molecular genetic analysis of the development of vertebrate and invertebrate model organisms has identified many developmental control genes which are highly conserved during evolution. An important role in the control of developmental decisions is executed by transcription factors, proteins which regulate the transcription of target genes, either as activators or repressors. In-vitro analyses have revealed that the protein product of the mouse <em>Brachyury (T)</em> gene, which is required in the differentiation of the notochord and the formation of posterior mesoderm, encodes a transcription factor with a novel DNA binding domain, the T domain. This unusually large DNA binding domain recognizes specifically the palindromic target sequence TTTCACACCTAGGTGTGAAA which was identified in an in-vitro binding site selection procedure. Upon binding to the palindromic target sequence, T protein activates transcription of a reporter gene. The DNA binding domain in the N-terminal half of the protein is physically separated from the domains in the C-terminal half which confer transcriptional modulation function. The T protein is the prototypical member of a growing class of molecules which share this conserved T domain.</p></div>\",\"PeriodicalId\":101155,\"journal\":{\"name\":\"Seminars in Developmental Biology\",\"volume\":\"6 6\",\"pages\":\"Pages 395-403\"},\"PeriodicalIF\":0.0000,\"publicationDate\":\"1995-12-01\",\"publicationTypes\":\"Journal Article\",\"fieldsOfStudy\":null,\"isOpenAccess\":false,\"openAccessPdf\":\"https://sci-hub-pdf.com/10.1016/S1044-5781(06)80003-4\",\"citationCount\":\"26\",\"resultStr\":null,\"platform\":\"Semanticscholar\",\"paperid\":null,\"PeriodicalName\":\"Seminars in Developmental Biology\",\"FirstCategoryId\":\"1085\",\"ListUrlMain\":\"https://www.sciencedirect.com/science/article/pii/S1044578106800034\",\"RegionNum\":0,\"RegionCategory\":null,\"ArticlePicture\":[],\"TitleCN\":null,\"AbstractTextCN\":null,\"PMCID\":null,\"EPubDate\":\"2007/5/17 0:00:00\",\"PubModel\":\"Epub\",\"JCR\":\"\",\"JCRName\":\"\",\"Score\":null,\"Total\":0}","platform":"Semanticscholar","paperid":null,"PeriodicalName":"Seminars in Developmental Biology","FirstCategoryId":"1085","ListUrlMain":"https://www.sciencedirect.com/science/article/pii/S1044578106800034","RegionNum":0,"RegionCategory":null,"ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":null,"EPubDate":"2007/5/17 0:00:00","PubModel":"Epub","JCR":"","JCRName":"","Score":null,"Total":0}
The Brachyury protein: A T-domain transcription factor
The molecular genetic analysis of the development of vertebrate and invertebrate model organisms has identified many developmental control genes which are highly conserved during evolution. An important role in the control of developmental decisions is executed by transcription factors, proteins which regulate the transcription of target genes, either as activators or repressors. In-vitro analyses have revealed that the protein product of the mouse Brachyury (T) gene, which is required in the differentiation of the notochord and the formation of posterior mesoderm, encodes a transcription factor with a novel DNA binding domain, the T domain. This unusually large DNA binding domain recognizes specifically the palindromic target sequence TTTCACACCTAGGTGTGAAA which was identified in an in-vitro binding site selection procedure. Upon binding to the palindromic target sequence, T protein activates transcription of a reporter gene. The DNA binding domain in the N-terminal half of the protein is physically separated from the domains in the C-terminal half which confer transcriptional modulation function. The T protein is the prototypical member of a growing class of molecules which share this conserved T domain.