Seminars in Developmental Biology最新文献

In zebrafish, the no tail mutant phenotype is caused by a mutation in the zebrafish homologue of the murine T gene. No tail mutant embryos fail to form a differentiated notochord, lack posterior structures, and have abnormally shaped anterior somites. The nervous system, including the floor plate, seems unaffected. The no tail gene is transiently expressed in cells of the endoderm and the mesoderm with a more persistent expression in the prospective notochord. Further analysis of the no tail phenotype, combined with studies of other zebrafish mutants that affect notochord formation and mesoderm patterning, will continue to contribute to our understanding of vertebate gastrulation.

Study of Xenopus Brachyury, Xbra, has concentrated on its activation by mesoderm induction and on the effects of over-expression of the gene. Activation of Xbra is an immediate-early response to the mesoderm-inducing factors FGF and activin. The effects of FGF can be mimicked by constitutively active components of the MAP kinase cascade. Over-expression of Xbra in presumptive ectodermal tissue causes ectopic mesoderm formation, with different types of mesoderm being formed in response to different concentrations of Xbra. Future work will study the Brachyury promoter and will attempt to identify targets of this presumptive transcription factor.

The molecular genetic analysis of the development of vertebrate and invertebrate model organisms has identified many developmental control genes which are highly conserved during evolution. An important role in the control of developmental decisions is executed by transcription factors, proteins which regulate the transcription of target genes, either as activators or repressors. In-vitro analyses have revealed that the protein product of the mouse Brachyury (T) gene, which is required in the differentiation of the notochord and the formation of posterior mesoderm, encodes a transcription factor with a novel DNA binding domain, the T domain. This unusually large DNA binding domain recognizes specifically the palindromic target sequence TTTCACACCTAGGTGTGAAA which was identified in an in-vitro binding site selection procedure. Upon binding to the palindromic target sequence, T protein activates transcription of a reporter gene. The DNA binding domain in the N-terminal half of the protein is physically separated from the domains in the C-terminal half which confer transcriptional modulation function. The T protein is the prototypical member of a growing class of molecules which share this conserved T domain.

The T-related gene (Trg) of Drosophila is a member of the T-box gene family and displays a high degree of similarity to the vertebrate Brachyury genes. Trg acts down-stream of the terminal gap genes tailless and huckebein and is required for the development of a particular organ, the hindgut. It is expressed throughout embryogenesis, first at the end of the blastoderm stage in the primordium of the hindgut close to the posterior pole of the embryo, then in the differentiating hindgut during gastrulation and organogenesis. A corresponding expression pattern of Trg homologues in the developing hindgut of short germ insects implies that the function of Trg in gut development has been highly conserved during evolution. This conservation in insects and the high similarity between Trg and the chordate Brachyury genes allows speculations about a link between gut parts of insects and notochord of chordates.

The isolation of the mouse Brachyury (T) gene has provided an important molecular tool for the investigation of mesoderm formation and axial development in vertebrates. The T gene is expressed specifically in nascent and early migrating mesoendoderm, and in notochord cells. It acts as a transcription factor controlling the differentiation of notochord cells, and the formation of mesoderm in the posterior of the embryo. Thus, mouse embryos lacking T function cannot undergo trunk nor tail formation. T plays distinct roles in the two cell types.

The first cell types that form in the mammalian embryo, the trophectoderm and the primitive endoderm, give rise to extraembryonic lineages critical for survival of the embryo in the uterine environment. Recent studies have begun to identify transcription factors and cell signalling pathways important to the establishment and maintenance of these lineages. In some instances, the factors involved are specific to extraembryonic cell types, but in other cases, the same molecules are used elsewhere in the development of the embryo itself. Delineation of embryonic versus extraembryonic function can be achieved by careful use of targeted mutagenesis and chimeric analysis.

A functional role of Hox genes in patterning the branchial region of the head was predicted on the basis of their expression patterns in rhombomeres, rhombencephalic neural crest cells and pharyngeal arch mesenchyme. The phenotypic consequences of the generation of both gain- and loss-of function Hox gene mutations not only strongly support this prediction, but also provide unexpected insights into the evolution of vertebrate body plan organization.

A major advance in developmental biology has been the identification of signalling molecules responsible for mediating pattern formation. The Wnts, a large family of secreted glycoproteins, are involved in numerous fundamental patterning processes throughout vertebrate embryogenesis. In-situ hybridization and ectopic expression studies have implicated Wnts in the control of gastrulation, CNS patterning, organogenesis, and limb development. Mutations in various mouse Wnt genes which have been generated using gene targeting techniques have allowed a direct assessment of the role of Wnt signals in these processes. In conjuction with the identification of factors involved in the interpretation of Wnt signals, these data begin to present a glimpse of the mechanism by which Wnt signals regulate embryonic development.