医学最新文献

Globally, there are over 3 million severe cases of influenza each year, leading to up to half a million deaths. This study provides a comprehensive analysis of the current status of children's influenza vaccine research over the past 20 years and explores potential future research trends, including improvements in vaccine coverage and strategies to address vaccine hesitancy. We extracted all research data on children's influenza vaccines from 2004 to 2024 using the Web of Science Core Collection (WOSCC). The contributions of various countries/regions, institutions, authors, and journals in this field were assessed, and research hotspots as well as promising future trends were predicted through keyword analysis using CiteSpace and VOSviewer. A total of 2,598 related publications from 2004 to 2024 were identified and collected for analysis. The United States (USA) and England emerged as the leading contributors with the highest number of published papers. AstraZeneca was identified as a key leader among research institutions, and Ambrose Christopher S was recognized as the most productive author in this field. The journals Vaccine and Human Vaccines & Immunotherapeutics stood out as the most prominent publications in this area. The keyword analysis highlighted that international research collaboration maybe a promising strategy for bridging global gaps; Addressing vaccine hesitancy could potentially increase vaccination coverage; Live attenuated vaccines, intranasal administration and universal vaccines are promising directions for future development. These insights highlight potential avenues for improving influenza vaccine coverage and inform strategies to mitigate vaccine hesitancy, crucial for protecting children and enhancing public health.

Background: In Egypt, there were 150,578 new cancer cases and 95,275 cancer deaths in 2022, indicating a substantial burden on patients and the healthcare system. The analysis aims to support decision-making related to investments in cancer prevention and new treatments, by highlighting the economic burden associated with five types of cancer.

Methods: The human capital approach was used to estimate productivity losses from premature mortality due to liver, lung, breast, bladder, and cervical cancer in Egypt in 2019 by calculating years of life lost (YLL), years of productive life lost (YPLL), and present value of future lost productivity (PVFLP). Mortality data were sourced from the World Health Organization (WHO), while life expectancy, retirement age, gross domestic product (GDP) per capita, and labor force participation rates were obtained from the World Bank. Income data, such as annual earnings and minimum wage were sourced from the Wage Indicator database. Deterministic sensitivity analysis (DSA) assessed the sensitivity of results to input variations.

Results: In 2019, Egypt had a total of 45,114 deaths, from liver, lung, breast, cervical, and bladder cancers, resulting in a productivity loss of $430,086,636. Liver cancer led to the most male deaths (17,745) and breast cancer to the most female deaths (6,754), with PVFLP of $232,663,468 and $130,745,592, respectively. The five cancers resulted in 551,336 YLL and 235,415 YPLL in Egypt. The total PVFLP was estimated at $217,224,178 for females and $212,862,458 for males, with a total PVFLP/death of $9,533. The DSA showed that the PVFLP was most sensitive to changes in the retirement age.

Conclusion: In conclusion, there is a substantial economic burden relating to premature cancer mortality in Egypt, highlighting that policies and treatment advances to decrease cancer are working, however, there is need for continuous prioritization of awareness programs, cancer screening and treatment advancements.

Knowledge of ovulatory cycle (KOC) is a crucial factor for successful conception. Despite sizable number of women suffering from infertility, empirical evidence on the relation between infertility and KOC is rare in South Asia. This study assesses the association between primary infertility and KOC. The data of ever-married women aged 20-49 gathered in the recent rounds of Demographic and Health Survey (DHS) for India (2019-2021), Bangladesh (2017-2018), Pakistan (2017-2018) and Nepal (2022) were analyzed. Bivariate analysis and binary logistic regression were conducted through Stata (V.17) with a 5% significance level. Women with no KOC in India [AOR:1.71, C.I.: (1.54, 1.9)] and Bangladesh [AOR:2.6, C.I.: (1.67, 4.06)] had higher odds of primary infertility than their counterparts with correct KOC. The study concludes that correct KOC is a significant predictor of primary infertility in India and Bangladesh and is insignificant in Pakistan and Nepal. Moreover, higher age at marriage and no-visit to healthcare facility were the other significant predictors of primary infertility in all four countries. Women who are struggling to conceive would benefit from education related to the timing and identification of the fertile window, which may be provided through primary healthcare providers.

Background: Taekwondo is a complex martial art that requires speed, balance, agility, and endurance. This study aims to examine the effects of nitrate and L-arginine supplementation on acute aerobic and anaerobic performance, balance, agility, and recovery in elite taekwondo athletes.

Method: This study was conducted as a double-blind, randomized, crossover study with the participation of 15 experienced taekwondo athletes aged 19.06 ± 0.96 years and 8.93 ± 1.27 years of training experience. Participants visited the laboratory a total of nine times, including a practice session and anthropometric measurements. These visits consisted of eight experimental sessions conducted at 72-hour intervals. The experimental sessions were conducted with nitrate, L-arginine, and a combination of both supplements (NIT*L-ARG) and placebo. Nitrate supplementation was provided by homogenizing fresh spinach (837.40 mg/kg), while L-ARG was given as a single dose of 6 g in powder form three hours before exercise.

Results: NIT*L-ARG supplementation significantly improved the anaerobic performance of athletes in Wingate peak power and peak power (w/kg) compared to placebo and in mean power compared to NIT, L-ARG, and PLA. In addition, NIT*L-ARG supplementation significantly improved blood lactate levels and agility performance immediately after Wingate and Shuttle run tests.

Conclusion: The combined intake of NIT*L-ARG was found to be effective in improving aerobic, anaerobic, and agility performances as well as fatigue levels of athletes. It was determined that taking NIT and L-ARG supplements alone contributed to the improvement of improving athletes' performance in Wingate mean power values and subsequent fatigue level compared to PLA.

Objectives: Controlling Nutritional Status (CONUT) Score is an effective tool for the assessment of malnutrition and proved to be associated with survival of Diffuse large B-cell lymphoma (DLBCL) patients. We investigated the impact of CONUT score on specific subgroups of DLBCL patients, including age and International prognostic Index (IPI) risk groups.

Methods: Data of 287 newly diagnosed DLBCL in the Third Affiliated Hospital of Soochow University were retrospectively collected. Baseline CONUT score, clinical data and survival information were recorded.

Results: With the standard cut-off value of 4 points, 88 (30.7%) patients were clarified as malnourished. During a median follow-up of 34 months, malnourished patients exhibited significant reduction in both progression-free survival (PFS) and overall survival (OS). The 3-year PFS rates for malnourished and well-nourished patients were 51.4% and 70.9% (p = 0.001), while the 3-year OS rates were 62.4% and 84.0% (p < 0.001). Malnutrition was demonstrated an independent predictor of OS in DLBCL patients (HR 2.220, 95% CI 1.307-3.772, p = 0.003). It could effectively identify patients with inferior OS in both low/intermediate-low risk and intermediate-high/high risk IPI groups. In the group of elderly patients aged over 60 years, malnutrition was independently associated with OS (HR 2.182, 95% CI 1.178-4.040, p = 0.024), but not PFS (HR 1.709, 95% CI 1.016-2.875, p = 0.070) after adjustment using the Benjamini-Hochberg procedure. Conversely, for younger patients, malnutrition did not demonstrate an independent impact on either PFS or OS.

Conclusion: Malnutrition evaluated by CONUT score was an independent predictor for the outcome of DLBCL patients, which is exclusively caused by its effect on elderly patients.

Objective: Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

Methods: The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

Results: The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

Conclusions: We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

Regulatory T cells (Tregs) contribute significantly to the immunosuppressive nature of the tumor microenvironment which is a main barrier for immunotherapies of solid cancers. Reducing Treg numbers enhances anti-tumor immune responses but current depletion strategies also impair effector T cells (Teffs), potentially leading to reduced anti-tumor immunity and/or autoimmune diseases. CD137 has been identified as the most differentially expressed gene between peripheral Tregs and intratumoral Tregs in virtually all solid cancers. Further, CD137 is expressed by malignant cells of certain cancers, making it a potential target for tumor immunotherapy. Here, we report the development of a fully human anti-human CD137 antibody of the IgG1 isotype, clone P1A1, that induces antibody-dependent cell-mediated cytotoxicity (ADCC) in CD137⁺ Tregs and cancer cells. P1A1 cross-reacts with murine CD137 which allowed testing murine chimeric P1A1 in syngeneic murine tumor models where P1A1 significantly reduced the number of CD137⁺ Tregs and inhibited tumor growth in a murine hepatocellular carcinoma (HCC) and a melanoma lung metastasis model. P1A1 can also be internalized thus enabling it as a carrier for drugs to target CD137⁺ Tregs and cancer cells. These anti-cancer properties suggest a translation of P1A1 to human immunotherapy.

Background: The body composition of National Collegiate Athletic Association (NCAA) athletes is well documented but no such data exist for university club sports athletes. Additionally, the majority of norms for NCAA athletes were created from individual methods requiring assumptions.

Objective: This study used a four-component (4C) model to measure the body composition of university club sports athletes.

Methods: Data were collected on club athletes participating in baseball, climbing, cycling, figure skating, gymnastics, ice hockey, lacrosse, pickleball, powerlifting, racquetball, rodeo, rugby, soccer, swimming, ultimate, and volleyball. The 4C model consisted of body volume, total body water, and bone mineral content measured by air displacement plethysmography, bioimpedance spectroscopy, and dual-energy x-ray absorptiometry, respectively. Percentile ranks were created for body fat percentage (%BF) and fat-free mass index (FFMI). Mean differences across teams were quantified with Cohen's d.

Results: In total, 225 athletes (137 men, 88 women) completed data collection. Athletes varied in competitive experience (1 to 22 y) and body mass index (16.9 to 36.4 kg·m^-2). The density of the FFM was significantly greater than the assumed value of 1.100 g·cm^-3 for both men (p = .043) and women (p = .011). The %BF ranged from 4.9% to 35.7% (14.3 ± 5.8% BF) for men and from 15.5% to 42.8% (25.2 ± 6.0% BF) for women. FFMI ranged from 15.6 kg·m^-2 to 26.8 kg·m^-2 (30.0 kg·m^-2 outlier removed) for men and from 14.1 kg·m^-2 to 22.6 kg·m^-2 for women. Differences across sports in %BF and FFMI were considered large-sized effects (d ≥ 0.80) for both men and women. Weight-sensitive sports (e.g. cycling and climbing) had the lightest athletes and were among the leanest, whereas power athletes (e.g. powerlifting and rugby) were among the heaviest athletes and had the highest FFMI.

Conclusions: Differences in %BF and FFMI are evident across sports. Due to the small sample size, use caution when interpreting the data as reference values for club sports athletes.

Drug-loaded liposomes incorporated in nanofibrous scaffolds is a promising approach as a multi-unit nanoscale system, which combines the merits of both liposomes and nanofibers (NFs), eliminating the drawback of liposomes' poor stability on the one hand and offering a higher potential of controlled drug release and enhanced therapeutic efficacy on the other hand. The current systematic review, which underwent a rigorous search process in PubMed, Web of Science, Scopus, Embase, and Central (Cochrane) employing (Liposome AND nanofib* AND electrosp*) as search keywords, aims to present the recent studies on using this synergic system for different therapeutic applications. The search was restricted to original, peer-reviewed studies published in English between 2014 and 2024. Of the 309 identified records, only 29 studies met the inclusion criteria. According to the literature, three different methods were identified to fabricate those nanofibrous liposomal scaffolds. The results consistently demonstrated the superiority of this dual system for numerous therapeutic applications in improving the therapy efficacy, enhancing both liposomes and drug stability, and releasing the encapsulated drug in a proper sustained release without significant initial burst release. Merging drug-loaded liposomes with NFs as liposomal nanofibrous scaffolds are a safe and efficient approach to deliver drug molecules and other substances for various pharmaceutical applications, particularly for wound dressing, tissue engineering, cancer therapy, and drug administration via the buccal and sublingual routes. However, further research is warranted to explore the potential of this system in other therapeutic applications.