医学最新文献

Purpose: Rugby sevens is a high-intensity contact sport often played in two-day tournaments. Caffeine is widely used by rugby players for its performance-enhancing effects. This study aimed to investigate the impact of caffeine supplementation on various performance metrics, including distance covered at different speeds, acceleration, deceleration, collisions, and repeated high-intensity efforts across four matches over two consecutive days in collegiate male rugby sevens players. Reactive agility, a key performance attribute in rugby sevens, was also assessed before each match.

Methods: A position-matched, double-blind, randomized crossover design was employed, with six male collegiate rugby players (mean height: 1.78 ± 0.09 m, mean weight: 81.3 ± 9.2 kg, mean age: 21.5 ± 0.8 years) participating in two trials. Each trial consisted of a two-day tournament, with two matches per day. Performance was monitored using global positioning system units to track distance covered in various speed zones, as well as total distance, frequency of acceleration, deceleration, collisions, and repeated high-intensity efforts.

Results: The results indicated that in the placebo trial, participants covered significantly more distance at a walking pace (0-6 km/h) in match 4 compared to match 3 (match 3: 480.3 ± 32.7 m; match 4: 629.4 ± 21.3 m, p < 0.001, d = 0.117). In the caffeine trial, players covered significantly more distance at a jogging pace (6-12 km/h) in match 4 compared to the placebo trial (caffeine: 405.9 ± 9.8 m; placebo: 303.6 ± 20.2 m, p = 0.015, d = 1.693). Reactive agility was significantly better in the caffeine trial before match 3 (caffeine trial: 1.80 ± 0.17 s; placebo trial: 2.07 ± 0.18 s, p = 0.038, d = 0.858).

Conclusions: Caffeine supplementation at 3 mg/kg may increase jogging and reduce walking and standing in the final match of a two-day rugby sevens tournament, while also improving reactive agility on the second day. This suggests that by mitigating fatigue in the later stages of the tournament, caffeine allowed players to shift from low-intensity activities to higher-intensity efforts. These adjustments may improve both offensive and defensive performance during rugby sevens matches. Therefore, rugby sevens players could benefit from taking caffeine supplements in the later stages of 2-day tournaments to optimize their performance.

Aims: Empagliflozin confers cardioprotective benefits among patients with heart failure, across the range of ejection fraction (EF), regardless of type 2 diabetes status. The long-term cost-effectiveness of empagliflozin for the treatment of heart failure (HF) in the Philippines remains unclear. This study aims to determine the economic benefit of adding empagliflozin to the standard of care (SoC) vs the SoC alone for HF in the Philippines.

Methods: Using a Markov model, we predicted lifetime costs and clinical outcomes associated with treating HF in the Philippine setting. We used estimates of treatment efficacy, event probabilities, and derivations of utilities from the EMPEROR trials. Costs were derived from hospital tariffs and expert consensus. Separate analyses were performed for patients with left ventricular EF > 40%, categorized under mid-range ejection fraction or preserved ejection fraction (HFmrEF/HFpEF), and patients with left EF ≤ 40%, categorized under HF with reduced ejection fraction (HFrEF).

Results: Our model predicted an average of 0.09 quality-adjusted life year (QALY) gains among HFmrEF/HFpEF patients and HFrEF patients when empagliflozin was compared to SoC. The addition of empagliflozin in the treatment results in a discounted incremental lifetime cost of PHP 62,692 (USD 1,129.99) and PHP 17,215 (USD 308.67) for HFmrEF/HFpEF and HFrEF, respectively. The incremental cost-effectiveness ratio (ICER) of empagliflozin is PHP 198,270 (USD 3,570.72)/QALY and PHP 742,604 (USD 13,385.08)/QALY for HFrEF and HFmrEF/HFpEF, respectively.

Limitations: This study employed parameters derived from short-term clinical trial data, alongside metrics representative of Asian populations, which are not specific to the Philippine cohort.

Conclusions: Adding empagliflozin to the SoC in comparison to the SoC is associated with improved clinical outcomes and quality-of-life, at additional costs for both HFrEF and HFmrEF/HFpEF.

Background: Chronic kidney disease (CKD) is a prevalent chronic, non-communicable disease. The long-term health effects of dietary live microbes, primarily probiotics, on CKD patients remain insufficiently understood. This study aims to investigate the association between dietary intake of live microbes and long-term health outcomes among individuals with CKD.

Methods: Utilizing the National Health and Nutrition Examination Survey (NHANES) database, Cox regression analysis assessed the association between medium and high categories dietary live microbe intake and health outcomes (all-cause, cardiovascular disease [CVD], and cancer-related mortality) in CKD patients.

Results: A total of 3,646 CKD patients were enrolled. During the follow-up period, 1,593 all-cause mortality events were recorded, including 478 CVD deaths and 268 cancer deaths. In the fully adjusted model, compared to CKD patients in the lowest quartile (quartile 1) of live microbes intake, those in quartiles 3 and 4 exhibited a 20% and 26% reduced risk of all-cause mortality, with hazard ratios (HR) of 0.80 (95% confidence interval, CI: 0.69, 0.94) and 0.74 (95% CI: 0.62, 0.90), respectively. Additionally, compared to those with low live microbe intake (quartile 1), higher live microbe intake in quartile 4 was associated with a 37% reduction in the risk of CVD mortality for CKD patients, with an HR of 0.63 (95% CI: 0.45, 0.88). Consistent results were observed in subgroup and sensitivity analyses. A significant negative association was observed between live microbe intake and the risk of all-cause mortality as well as CVD mortality in the CKD population, with a p-value for trend < 0.05.

Conclusion: Our study indicated that high dietary live microbe intake could mitigate the risk of all-cause and CVD mortality in CKD patients. These findings support the inclusion of live microbes in dietary recommendations, highlighting their significant roles in CKD.

Background: Vascular calcification is highly prevalent and associated with mortality in hemodialysis patients. However, extreme splanchnic arterial calcification in calciphylaxis with poor prognosis raises questions regarding the reliability of previous vascular calcification scoring methods. Therefore, this study aimed to examine the distribution characteristics of abdominal aortic branch calcification and identify a more reliable predictor of mortality in hemodialysis patients.

Methods: The cohort study included 237 hemodialysis patients. The distribution characteristics of abdominal aortic branch calcification were determined by quantifying the calcification volumes. The primary and secondary outcomes were all-cause mortality and new-onset cardiovascular events, respectively. We compared the prognostic values of abdominal aortic branch calcification and constructed a predictive nomogram model.

Results: The prevalence of abdominal vascular calcification in hemodialysis patients was 95.36%, with the highest prevalence in the abdominal aorta (88.61%) and internal iliac artery (85.65%). During a median follow-up period of 3.92 years, 137 patients died. Internal iliac artery and mesenteric artery calcification showed the greatest predictive values for mortality. Internal iliac artery calcification and serum albumin level were independently associated with mortality in hemodialysis patients (p < .001). The nomogram model constructed with internal iliac artery calcification, serum albumin level, age, and comorbid cardiovascular disease was well discriminative, calibrated, and clinically applicable for predicting 3-year survival.

Conclusion: Abdominal aortic branch calcification, particularly internal iliac artery calcification, is a preferable prognostic predictor than abdominal aorta or coronary artery calcification in hemodialysis patients.

Allogeneic hematopoietic stem cell transplantation (Allo-HSCT) remains the mainstay of treatment for adults with high-risk acute lymphoblastic leukemia (ALL). Due to the crucial role of measurable residual disease (MRD) before Allo-HSCT in predicting relapse and the promising anti-leukemia effect of blinatumomab, we documented a short-course, low-dose conditioning regimen incorporating blinatumomab for Allo-HSCT in three ALL patients with positive MRD. Following the administration of the blinatumomab-containing conditioning regimen, all patients attained complete remission (CR) with negative MRD status, and no severe adverse events were observed. After a 2-year follow-up, 2/3 of patients remained disease-free and attained long-term survival following transplantation. These cases indicated a short-term blinatumomab conditioning regimen may effectively prolong patient survival, improve prognosis, and offer a safe and cost-effective treatment for high-risk ALL patients with positive MRD. The addition of blinatumomab to the conditioning regimen of Allo-HSCT is feasible for high-risk ALL patients with positive MRD.

Background and purpose: Bone metastasis is common for breast cancer and associated with poor prognosis. Currently, radiotherapy (RT) serves as the standard treatment for patients exhibiting symptoms of bone metastasis to alleviate pain. Whether earlier application of RT will better control bone metastasis remains unclear.

Methods: We utilized a mouse model of breast cancer bone metastasis by intra-femoral injection of 4T1-luc breast tumor cells. The bone metastasis was treated by RT using various doses, timings, and modalities. Tumor growth was assessed through bioluminescence imaging, and lung metastases was quantified following lung tissue fixation. Flow cytometry was employed to analyze alterations in immune cell populations.

Results: Single high-dose RT suppressed tumor growth of bone metastases, but caused severe side effects. Conversely, fractionated RT mitigated tumor growth in bone metastases with fewer adverse effects. Fractioned RT initiated at the early stage of bone metastasis effectively inhibited tumor growth in the bone, suppressed secondary lung metastases, and prolonged mouse survival. In line with the known pro- and anti-metastatic effects of neutrophils and T cells in breast cancer, respectively, earlier fractioned RT consistently decreased the proportions of neutrophils while increased the proportions of T cells in both the bone and the lung tissues.

Conclusion: The data suggest that fractionated RT can inhibit the progression of early stage of bone metastasis and reduce secondary lung metastasis, leading to favorable outcomes. Therefore, these findings provide preclinical evidence to support the application of fractionated RT to treat patients with bone metastasis as earlier as possible.

Objective: Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

Methods: The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

Results: The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

Conclusions: We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

Background: Athletes' oral health can impact overall well-being and sports performance. This study aimed to evaluate the interactions between eating habits and oral health of 120 young athletes as compared to 30 age-matched individuals not practicing sports based on a questionnaire and the analysis of saliva.

Methods: One hundred twenty subjects practicing various sports activities (test group) and 30 subjects not practicing sports (control group) were selected. A self-administered questionnaire was used to obtain personal data, hours and frequency of weekly training, complete pathological history, history of hard and soft tissues of the oral cavity, family history, and oral hygiene practices. The eating habits of the young participants were analyzed by investigating the number of daily meals; use and frequency in sports practice of supplements/energy drinks, fruit/juices, snacks, chocolate; daily diet; and differences between usual diet and pre-competition diet. At baseline (T0), each participant was clinically assessed for the determination of the number of decayed, missing, and filled teeth (DMFT), Silness & Löe Plaque Index (PI), and the Löe & Silness Gingival Index (GI) and qualitative analysis for the presence/absence of stains and dental erosions. At T0, before (T1) and after training sessions (T2), saliva was collected to determine resting pH, Streptococcus mutans, and Lactobacillus spp counts.

Results: Test groups were trained more than 2 h, 5 times a week. Soccer players and skiers had a high percentage of caries; water polo players demonstrated the highest percentage of erosions and dental stains. Salivary resting pH showed statistically different values in three different observations between the groups. S. mutans was harbored by 60% of soccer and 70% of water polo players, while Lactobacillus spp in 43.33% of the swimmers and soccer players. Combining all the 56 variables including the clinical examination, self-reported parameters, and salivary analysis, we have identified water polo players as a distinct at-risk group for developing dental defects, expressed as an aggregate disease score. In particular, we have found that energy snacks/chocolate intake is strongly associated with ratio of S. mutans/Lactobacillus spp and that S. mutans is linked to dental defects (R = 0.88). Linear regression analysis indicates that energy snacks/chocolate intake in the study population represents a strong driver for oral dysbiosis and dental disease.

Conclusions: Our study clearly shows that athletes should follow a balanced diet that not only satisfies their nutritional needs but also avoids oral dysbiosis and subsequent dental damage.

Nivolumab plus ipilimumab (aCTLA-4/aPD-1) combination therapy has significantly improved clinical outcomes in patients with metastatic melanoma, with 50%-60% of patients responding to treatment, but predictors of response are poorly characterized. We hypothesized that circulating cytokines and peripheral white blood cells may predict response to therapy and evaluated 15 cytokines and complete blood counts (CBC with differentials) from 89 patients with advanced melanoma treated with combination therapy from three points in time: pre-treatment, one month and approximately three months after starting therapy. Clinical endpoints evaluated included durable clinical benefit (DCB), progression-free survival (PFS), and overall survival (OS). A parsimonious predictive model was developed to identify cytokines predictors of response to combination therapy. In this study, we found that pre-treatment, patients with DCB had higher IL-23, lower CXCL6, and lower IL-10 levels. Lower NLR one month after starting therapy predicted better PFS and OS, primarily driven by an increase in absolute lymphocytes. A multivariate model demonstrated that baseline CXCL6, IL-10, IL-23 were independent predictors of therapy response, and the combined model has reached an area under the curve (AUC) of 0.79 in prediction of response to combination therapy. Our study identified baseline CXCL6, IL-23, and IL-10 as predictors of response to aCTLA4/aPD1 combination therapy among patients with metastatic melanoma. This study also provides a framework for identifying patients who are likely to respond to combination ICB, as well as a subset of patients with high risk of developing resistance and are thus in need of alternative therapeutic options, such as clinical trials.