Molecular Biotechnology最新文献

Plant viruses need host factors to complete their life cycle. The eukaryotic translation initiation factor 4E (eIF4E) and its isoforms are the host factors essential for infection by plant viruses in the genus Potyvirus. The present study describes the characterization of eIF4E gene in banana cultivar Nendran, and its interaction with the viral genome-linked protein (VPg) of banana bract mosaic virus (BBrMV). The in-silico analysis of 853 bp coding mRNA region of eIF4E revealed the presence of five exons. The deduced amino acid sequence had 99.58% identity with the predicted protein sequence of the eIF4E-1 in Musa acuminata subspecies malaccensis. Expression profiling of eIF4E gene in banana cultivar Nendran using qRT-PCR revealed up to 16.9-fold up-regulation of the gene in response to BBrMV infection, indicating its role in disease development. The three-dimensional models of the eIF4E and VPg proteins were generated to deduce the precise interaction between the two proteins. Using the online server ZDOCK, ten interaction complexes were obtained. In nine out of the ten complexes, the maximum number of residues of the eIF4E interacted with the Tyrosine-63rd residue of VPg. The corresponding nucleotides were identified as the potential targets for editing the host eIF4E gene to impart potyvirus resistance.

Staphylococcus warneri is a gram-positive mesophilic bacterium, resilient to extreme environmental conditions. To unravel its Osmotic Tolerance Response (OTR), we conducted proteomic and metabolomic analyses under drought (PEG) and salt (NaCl) stresses. Our findings revealed 1340 differentially expressed proteins (DEPs) across all treatments. Interestingly, majority of these DEPs were part of common pathways activated by S. warneri. CPD1 in response to osmotic stress. Notably, the bacterial isolate exhibited increased expression of lysophospholipases associated with biofilm formation and protection from environmental stresses, transglycosylases involved in peptidoglycan biosynthesis, and acetoin reductase linked to acetoin metabolism. The upregulation of global ion transporters, including ABC transporters, potassium ion transport, and glutamate transport, indicated the bacterium's ability to maintain ionic balance under stress conditions. Protein-protein docking analysis revealed highest interactions with thioredoxin and alpha-acetolactate decarboxylase, highlighting their crucial roles in the mechanisms of osmotic stress tolerance in S. warneri CPD1. Metabolomic results demonstrated significant alterations in fatty acids and amino acids. In the greenhouse experiment, the bacterial isolate significantly enhanced wheat biomass, nutrient content, photosynthesis, and proline levels under stress conditions, making it a promising bacterial inoculant and biostimulant for improving crop productivity in challenging environments.

In Salmonella Typhimurium, efflux pump proteins, such as AcrD actively expel drugs and hazardous chemicals from bacterial cells, resulting in treatment failure and the emergence of antibiotic-resistant variants. Focusing on AcrD may lead to the development of novel antimicrobials against multidrug-resistant bacteria. However, challenges persist in achieving high selectivity, low toxicity, and effective bacterial penetration. Natural products, particularly microbial secondary metabolites, possess distinct chemical structures that may target the efflux pump systems. The efflux pump inhibitor capabilities of Fusarium nygamai compounds in Salmonella have not been previously investigated. This study employed molecular docking and molecular dynamics simulations to evaluate 25 F. nygamai compounds as potential inhibitors of AcrD. Additionally, the pharmacological characteristics of these substances were examined. Molecular docking results revealed that 3,6-Dimethoxy-2,5-dinitrobenzonitrile, methyl (2-oxo-3-phenylquinoxalin-1(2H)-yl)acetate, and 7-Methyl-5-nitro-1,4-dihydro-quinoxaline-2,3-dione exhibited the highest binding energies with AcrD. Furthermore, molecular dynamics simulations indicated stable ligand-receptor complex variations over time. This study contributes to the efforts against antibiotic resistance and the improvement of Salmonella infection treatment outcomes globally by facilitating the development of novel therapeutic approaches and enhancing antibiotic efficacy.

The immune system comprises various regulators and effectors that elicit immune responses against various attacks on the body. The pathogenesis of autoimmune diseases is derived from the deregulated expression of cytokines, the major regulators of the immune system. Among cytokines, interleukins have a major influence on immune-mediated diseases. These interleukins initiate the immune response against healthy and normal cells of the body, resulting in immune-mediated disease. The major interleukins in this respect are IL-1, IL-3, IL-4, IL-6, IL-10 and IL-12 which cause immune responses such as excessive inflammation, loss of immune tolerance, altered T-cell differentiation, immune suppression dysfunction, and inflammatory cell recruitment. Systemic Lupus Erythematosus (SLE) is an autoimmune illness characterized by dysregulation of interleukins. These immune responses are the signs of diseases such as rheumatoid arthritis, inflammatory bowel disease, psoriasis, type I diabetes, and multiple sclerosis.

The development of genome technology has opened new possibilities for comparative primate genomics. Non-human primates share approximately 98% genome similarity and provides vital information into the genetic similarities and variances among species utilized as disease models. DNA study links unique genetic variations to common facial attributes such as nose and eyes. This is because of higher adaptation and improved cognitive skills over these sensual areas. Non-protein coding sequences represent approximately 85% of the human DNA under evolutionary restrictions, and the primary part of this is the cis regulatory regions. In this study, a total of 103 tissue specific human enhancers were finalized with help of VISTA Enhancer Browser that showed distinctive expression in the facial tissues and their orthologs were collected. A total of 43 out of 190 transcription factors from TRANSFAC were seen as binding in both Human and Non-Human primate enhancers. It was observed that factor binding sites of 7 of the 43 transcription factors were exclusively gained in the human eye and nose enhancers (Oct, Pax, Sox, MyoD, Foxd3, cRel and Gata). Furthermore, we performed molecular docking through PyMol; DNA & Protein (pdb) structures were modelled by SCFBio & SWISSMODEL respectively to observe interactions of the transcription factors, either by placing the contact surface of the protein exclusively to identify the DNA, to enable a representation to gain information about identification and genetic expression.

Accurate malaria diagnosis is crucial for effective disease management as different Plasmodium species require specific treatment regimens. Current detection methods have limitations related to sensitivity and specificity. This is mainly due to employing similar targets such as 18S rRNA, Pf-ldh, Pf-hrp-2, and aldolase with significant homology to human counterparts. Targeting Plasmodium fikk kinases that are unique to P. falciparum offers a novel approach for developing potential biomarkers. We have identified exclusive regions of fikk kinases using in-silico PCR and later validated our findings using in-vitro PCR. We observed exceptional sensitivity with our designed primers of the targeted fikk kinases, with the detection limit going as low as 10^-5 ng level of parasite DNA and 0.0003% parasitemia. The shortlisted primers also selectively identified P. falciparum in the presence of Plasmodium vivax or several other bacterial, viral, and fungal pathogens. Detection of mock patient samples indicates that the fikk-based PCR diagnosis is giving accurate results, and it is much better than the existing method. Thus, we show that the fikk kinases from P. falciparum are excellent targets for developing novel biomarkers with high sensitivity and specificity.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target. A molecular beacon of 33 nucleotides was designed with the sequence 5'[Fluorescein] ATAGTCCTTCAACAATCTTATCCCTAGCACTAT[Dabcyl]3', incorporating stem and loop regions. Secondary and tertiary structure characterizations confirmed the desired stem-loop structure without internal secondary structures. The thermal stability of the molecular beacon-target complex was studied using a temperature vs. Gibbs free energy change plot, melting curve analysis based on absorbance vs. temperature, and an experimental fluorescence resonance energy transfer melting assay. The melting temperature of the molecular beacon-target complex was experimentally determined to be 62 °C. The spectral analysis showed fluorescence restoration in the presence of the synthetic VP6 target. The assay conditions were optimized with an excitation wavelength of 470 nm and a 10-min incubation time. The assay demonstrated a linear correlation between fluorescence intensity restoration and target concentration, with a limit of detection of 18.8 nM. Interference studies with single mismatch, double mismatch, and scrambled targets revealed that the molecular beacon has strong specificity for the VP6 target, effectively discriminating against non-target sequences. This work demonstrates the molecular beacon's potential as a sensitive and specific tool for detecting rotavirus A VP6 gene, with promising applications in diagnostic assays for the rotavirus disease management.

New technologies have shown that most of the genome comprises transcripts that cannot code for proteins and are referred to as non-coding RNAs (ncRNAs). Some ncRNAs, like long non-coding RNAs (lncRNAs) and microRNAs (miRNAs), are of substantial interest because of their critical function in controlling genes and numerous biological activities. The expression levels and function of miRNAs and lncRNAs are rigorously monitored throughout developmental processes and the maintenance of physiological homeostasis. Due to their critical roles, any dysregulation or changes in their expression can significantly influence the pathogenesis of various human diseases. The interactions between miRNAs and lncRNAs have been found to influence gene expression in various ways. These interactions significantly influence the understanding of disease etiology, cellular processes, and potential therapeutic targets. Different experimental and in silico methods can be used to investigate miRNA-lncRNA interactions. By aiding the elucidation of miRNA-lncRNA interactions and deepening the understanding of post-transcriptional gene regulation, researchers can open a new window for designing hypotheses, conducting experiments, and discovering methods for diagnosing and treating complex human diseases. This review briefly summarizes miRNA and lncRNA functions, discusses their interaction mechanisms, and examines the experimental and computational methods used to study these interactions. Additionally, we highlight significant studies on lncRNA and miRNA interactions in various diseases from 2000 to 2024, using the academic research databases such as PubMed, Google Scholar, ScienceDirect, and Scopus.

This study revealed the characteristics of the ethanol extract of Origanum vulgare L. subsp. vulgare, copper, iron, and silver nanoparticles (CuNPs, FeNPs, AgNPs) were synthesized with the extracts for the first time. The NPs were characterized using field emission scanning electron microscopes (FE-SEM), field emission scanning electron microscope-energy-dispersive X-ray analysis (FESEM-EDX), transmission electron microscopy (TEM), and Fourier transform infrared spectroscopy (FT-IR). UV-Vis spectrophotometry is used for the confirmation of NPs. The extract had bioactive components, including thymol (35.99%) and naringenin (41.02 µg/g). Molecular docking of thymol/naringenin-AgNPs complexes with the PapR7 C-terminus produced MolDock scores of - 122.545 and - 94.929 for naringenin-AgNPs and thymol-AgNPs. AgNPs and CuNPs exhibited potent antibacterial activity against Bacillus cereus, Staphylococcus aureus, and Pseudomonas aeruginosa. AgNPs exhibited protease activity (5 mg/mL), and CuNPs exhibited lipase activity (5 and 10 mg/mL). FeNPs exhibited weak inhibitory properties (IC₅₀ > 9 mg/mL) and did not show any detectable enzymatic activity.