<p><p>The roots of Salvia yunnanensis, an herbaceous perennial widely distributed in Southwest China, is often used as a substitute for S. miltiorrhiza, a highly valued plant in traditional Chinese medicine (Wu et al. 2014). In June 2023, wilted plants of S. yunnanensis were observed in Wenshan City (23.20°N, 104.01°E), China. The average disease incidence was 40% to 65% and the total area affected by the disease was approximately 50 ha. The infected plants displayed wilted leaves, black necrotic lesions on roots, and eventually plant death. Fungal colonies with similar morphology were consistently isolated from the symptomatic roots. Eighteen monosporic isolates were individually cultured on potato dextrose agar (PDA) in separate petri dishes at 25 ± 1°C in darkness. After 7 days, the mycelia within the colonies exhibited a cottony texture and the colors ranged from white to pink or purple, while their reverse sides were white to purple. After 20 days incubation on carnation leaf agar (CLA) medium, spore characteristics of the isolates were evaluated (Zheng et al. 2024). On CLA medium, macroconidia had 2 to 5 septa, usually 3 septa, measuring 21.7 to 39.8 × 4.0 to 6.5 μm (n = 100). Microconidia were falciform, slightly curved or straight, measuring 6.8 to 15.4 × 2.5 to 5.4 μm (n = 100), with 0 to 1 septa. Chlamydospores were globose to subglobose, intercalary or terminal, with an average diameter of 8.9 μm (n = 100). Morphologically, the isolates were identified as Fusarium oxysporum (Lombard et al. 2019; Zheng et al. 2024). To confirm the identification, the translation elongation factor 1-α (EF1α) region was amplified with the primers EF-1/EF-2 (O'Donnell et al. 1998) and the RNA polymerase second largest subunit region (RPB2) was amplified with the primers fRPB2-6f/fRPB2-7cr (Eddouzi et al. 2013). The EF1α (GenBank accession no. PP805676) and RPB2 (PQ383276) sequences of isolate DS10-1 were compared with all sequences in the FUSARIUM ID database (O'Donnell et al. 2022) using polyphasic identification. The highest similarity (100%) was with F. oxysporum isolates, including the ex-epitype of Fusarium cugennagense isolate InaCC F984 (100% similarity). To further assess the phylogenetic relationships, a phylogenetic tree was constructed based on the Neighbor-Joining method in MEGA-X (Kumar et al. 2018). The tree confirmed that the isolate DS10-1 was closely related to F. oxysporum. Pathogenicity tests of the 18 isolates were conducted on five healthy one-year-old S. yunnanensis plants per isolate. Inoculum (1 ml of 106 conidia/ml) of each strain was brushed onto the roots of individual plants with a paintbrush. As controls, five plants were inoculated with sterile water. All plants were potted in plastic containers (diameter = 25 cm, five plants per pot) filled with a sterilized substrate mixture of sand and vermiculite (1:1, v/v), and maintained in the greenhouse at 20 to 26°C with 80% relative humidity. After 45 days, symptoms similar to those
{"title":"First Report of <i>Fusarium oxysporum</i> Causing Root Rot on <i>Salvia yunnanensis</i> in China.","authors":"Ying-Shu Pan, Shang-Ge Huang, Zhengpan Xiang, Zhong-Shun Mao, Yue-Juan Long, Hui Fang, Jinlong Cai, Yong Wang, Zhong-Jian Chen","doi":"10.1094/PDIS-11-24-2353-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-11-24-2353-PDN","url":null,"abstract":"<p><p>The roots of Salvia yunnanensis, an herbaceous perennial widely distributed in Southwest China, is often used as a substitute for S. miltiorrhiza, a highly valued plant in traditional Chinese medicine (Wu et al. 2014). In June 2023, wilted plants of S. yunnanensis were observed in Wenshan City (23.20°N, 104.01°E), China. The average disease incidence was 40% to 65% and the total area affected by the disease was approximately 50 ha. The infected plants displayed wilted leaves, black necrotic lesions on roots, and eventually plant death. Fungal colonies with similar morphology were consistently isolated from the symptomatic roots. Eighteen monosporic isolates were individually cultured on potato dextrose agar (PDA) in separate petri dishes at 25 ± 1°C in darkness. After 7 days, the mycelia within the colonies exhibited a cottony texture and the colors ranged from white to pink or purple, while their reverse sides were white to purple. After 20 days incubation on carnation leaf agar (CLA) medium, spore characteristics of the isolates were evaluated (Zheng et al. 2024). On CLA medium, macroconidia had 2 to 5 septa, usually 3 septa, measuring 21.7 to 39.8 × 4.0 to 6.5 μm (n = 100). Microconidia were falciform, slightly curved or straight, measuring 6.8 to 15.4 × 2.5 to 5.4 μm (n = 100), with 0 to 1 septa. Chlamydospores were globose to subglobose, intercalary or terminal, with an average diameter of 8.9 μm (n = 100). Morphologically, the isolates were identified as Fusarium oxysporum (Lombard et al. 2019; Zheng et al. 2024). To confirm the identification, the translation elongation factor 1-α (EF1α) region was amplified with the primers EF-1/EF-2 (O'Donnell et al. 1998) and the RNA polymerase second largest subunit region (RPB2) was amplified with the primers fRPB2-6f/fRPB2-7cr (Eddouzi et al. 2013). The EF1α (GenBank accession no. PP805676) and RPB2 (PQ383276) sequences of isolate DS10-1 were compared with all sequences in the FUSARIUM ID database (O'Donnell et al. 2022) using polyphasic identification. The highest similarity (100%) was with F. oxysporum isolates, including the ex-epitype of Fusarium cugennagense isolate InaCC F984 (100% similarity). To further assess the phylogenetic relationships, a phylogenetic tree was constructed based on the Neighbor-Joining method in MEGA-X (Kumar et al. 2018). The tree confirmed that the isolate DS10-1 was closely related to F. oxysporum. Pathogenicity tests of the 18 isolates were conducted on five healthy one-year-old S. yunnanensis plants per isolate. Inoculum (1 ml of 106 conidia/ml) of each strain was brushed onto the roots of individual plants with a paintbrush. As controls, five plants were inoculated with sterile water. All plants were potted in plastic containers (diameter = 25 cm, five plants per pot) filled with a sterilized substrate mixture of sand and vermiculite (1:1, v/v), and maintained in the greenhouse at 20 to 26°C with 80% relative humidity. After 45 days, symptoms similar to those ","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143067245","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
<p><p>Manglietia decidua is an extremely endangered species, known for its limited population and a narrow distribution range restricted to China (Yu 1994). In October 2021, a leaf disease affecting the foliage of 3-year-old M. decidua was observed at the nursery garden of the Yichun Forestry Institute of Jiangxi Province (27°55'52.7"N, 114°17'36.4"E), with approximately 60% disease incidence. Initially, small reddish-brown specks with round or oval-shaped spots appeared. These spots gradually expanded, resulting in large irregular lesions with grayish-white centers. Furthermore, the affected areas exhibited desiccation and curling, with lesion diameters exceeding two cm. Fifteen diseased leaves were collected to isolate the pathogen using the method described by Zhang et al. (2021). Out of 40 fungal isolates obtained, 28 exhibited consistent culture characteristics and were identified as Pestalotiopsis sp.. We chose HML2-1 as the representative for morphological research. Colonies on Potato Dextrose Agar (PDA) reached a diameter of 80 mm after seven days at 25°C, displaying a pale honey-colored appearance with fluffy aerial mycelia arranged in a concentric-pattern, while the back of the colony appeared orange. Conidia were fusoid and ellipsoidappearing straight to slightly curved, composed of five cells, with four septa at which were slightly constricted, and measured 17.5-22.5 × 5-7.5 µm. The 3 median cells exhibited a brown color; the apical cells were conical and colorless, featuring 2-3 branches at the top as flagella; the basal cells were conical, transparent, and smooth. For further identification, three isolates were selected for the amplification and sequencing of three loci: the internal transcribed spacer (ITS), the partial translation elongation factor1-alpha (TEF1) and beta-tubulin (TUB2). The sequences were deposited in GenBank (ITS: OR415306-OR415308; TEF1: OR420799, PP278043, PP278044; TUB2: OR420798, PP278045, PP278046). All three DNA sequences of HML2-1 had a high identity to P. lushanensis (the ex-type isolate LC4344) with the accession numbers KX895005 (100%), KX895223 (100%) and KX895337 (99.34%), respectively. The multi-locus phylogenetic tree employing W-IQ-TREE (Trifinopoulos et al. 2016), revealed that the studied three isolates clustered in P. lushanensis clade with strong support. Based on morphological and molecular evidence, the isolate HML2-1 was identified as P. lushanensis, despite the fact that conidia sizes are smaller than those of type strain (Liu et al. 2017). To verify pathogenicity, a 20 µL conidial suspension (5×105 conidia/mL) of isolate HML2-1 was added to each leaf from an 8-year-old tree in the field, with 10 leaves punctured and 10 leaves left intact. Control including wounded or unwounded leaves were treated with sterile water in another tree. The treated leaves were wrapped in plastic bags to maintain moisture. After three to seven days, field-inoculated leaves exhibited typical reddish-brown lesions
{"title":"First report of <i>Pestalotiopsis lushanensis</i> causing leaf spot of <i>Manglietia decidua</i> (Magnoliaceae) in China.","authors":"Huanhuan Liu, Chongli Sun, Baixun Zhou, Dong Li, Qingni Song, Jun Liu, Fenggang Luan, Sheng-Li Zhang","doi":"10.1094/PDIS-04-24-0841-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-04-24-0841-PDN","url":null,"abstract":"<p><p>Manglietia decidua is an extremely endangered species, known for its limited population and a narrow distribution range restricted to China (Yu 1994). In October 2021, a leaf disease affecting the foliage of 3-year-old M. decidua was observed at the nursery garden of the Yichun Forestry Institute of Jiangxi Province (27°55'52.7\"N, 114°17'36.4\"E), with approximately 60% disease incidence. Initially, small reddish-brown specks with round or oval-shaped spots appeared. These spots gradually expanded, resulting in large irregular lesions with grayish-white centers. Furthermore, the affected areas exhibited desiccation and curling, with lesion diameters exceeding two cm. Fifteen diseased leaves were collected to isolate the pathogen using the method described by Zhang et al. (2021). Out of 40 fungal isolates obtained, 28 exhibited consistent culture characteristics and were identified as Pestalotiopsis sp.. We chose HML2-1 as the representative for morphological research. Colonies on Potato Dextrose Agar (PDA) reached a diameter of 80 mm after seven days at 25°C, displaying a pale honey-colored appearance with fluffy aerial mycelia arranged in a concentric-pattern, while the back of the colony appeared orange. Conidia were fusoid and ellipsoidappearing straight to slightly curved, composed of five cells, with four septa at which were slightly constricted, and measured 17.5-22.5 × 5-7.5 µm. The 3 median cells exhibited a brown color; the apical cells were conical and colorless, featuring 2-3 branches at the top as flagella; the basal cells were conical, transparent, and smooth. For further identification, three isolates were selected for the amplification and sequencing of three loci: the internal transcribed spacer (ITS), the partial translation elongation factor1-alpha (TEF1) and beta-tubulin (TUB2). The sequences were deposited in GenBank (ITS: OR415306-OR415308; TEF1: OR420799, PP278043, PP278044; TUB2: OR420798, PP278045, PP278046). All three DNA sequences of HML2-1 had a high identity to P. lushanensis (the ex-type isolate LC4344) with the accession numbers KX895005 (100%), KX895223 (100%) and KX895337 (99.34%), respectively. The multi-locus phylogenetic tree employing W-IQ-TREE (Trifinopoulos et al. 2016), revealed that the studied three isolates clustered in P. lushanensis clade with strong support. Based on morphological and molecular evidence, the isolate HML2-1 was identified as P. lushanensis, despite the fact that conidia sizes are smaller than those of type strain (Liu et al. 2017). To verify pathogenicity, a 20 µL conidial suspension (5×105 conidia/mL) of isolate HML2-1 was added to each leaf from an 8-year-old tree in the field, with 10 leaves punctured and 10 leaves left intact. Control including wounded or unwounded leaves were treated with sterile water in another tree. The treated leaves were wrapped in plastic bags to maintain moisture. After three to seven days, field-inoculated leaves exhibited typical reddish-brown lesions","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143067192","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2025-01-28DOI: 10.1094/PDIS-11-24-2349-PDN
Pan Xie, Shuaishuai Sha, Hongyue Li, Hanhan Zhai
<p><p>Fig (Ficus carica L.) holds economic significance in Atushi, Xinjiang, but as fig cultivation expands, disease prevalence has risen. In July 2024, approximately 22% of harvested fig (cv. Xinjiang Zaohuang) from 20 commercial orchards (covering 40 hectares) in Atushi (39°39'37.65" N, 76°14'3.62" E) showed varying degrees of fruit rot symptoms. The initial symptoms were characterized by the appearance of small, brown lesions on the fruit surface. These lesions rapidly progressed into water-soaked spots, which expanded quickly. As the disease advanced, the affected areas became covered with dense, white, fluffy mycelia, accompanied by prominent black sporulation. In later stages, the infected tissues softened further, ultimately resulting in the complete decay of the fruit. Twenty diseased fig were collected from the sampling site. Tissue samples (5×5×5 mm) were cut at the diseased-healthy junction, surface-sterilized in 0.5% NaClO for 1 minute, rinsed twice in sterile distilled water, air-dried, and transferred aseptically onto potato dextrose agar (PDA), and incubated at 25°C for 5 days with a 12-hour photoperiod. Fifteen isolates were obtained from the infected tissues, with two representative isolates (WH 12 and WH 23) selected for further study due to morphological similarity. The fungal colonies initially appeared as white mycelium, later turning olive green to grayish-black. Colony growth was rapid (32 mm/day). Arthrospores were colorless to light brown, short columnar, aseptate, with a truncated base, 0 to 1 septate, averaging 11.9±2.3×3.6±0.8 μm (n = 50), and sometimes formed arthric chains. Chlamydospores were dark brown, round or oval, 0 to 1 septate, averaging 7.26±1.7×5.05±1.0 μm (n = 50). Genomic DNA was extracted from the two isolates. The internal transcribed spacer (ITS), translation elongation factor 1-alpha (TEF1-α), and beta-tubulin (TUB2) genes were amplified using primers ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone & Kohn. 1999), and BT2a/BT2b (Glass & Donaldson. 1995), respectively, and sequences were deposited in GenBank (ITS: PQ555020, PQ555021; TUB2: PQ557519, PQ557521; TEF1-α: PQ557520, PQ557522). BLAST analysis revealed 99-100% similarity to Neoscytalidium dimidiatum Arp2-D (ITS: MK813852; TUB2: MK816354; TEF1-α: MK816355). Phylogenetic analysis using IQ-Tree and MrBayes3.2.7 based on concatenated ITS-TEF1-TUB sequences showed WH 12 and WH 23 clustering with N. dimidiatum Arp2-D (99% bootstrap). Morphological and molecular data identified the isolates as N. dimidiatum (Penz.) Crous & Slippers (Crous et al. 2006). Pathogenicity tests were conducted on 20 healthy fig (cv. Xinjiang Zaohuang) by inoculating each fruit with 10 µl of a WH 12 conidial suspension (1 × 10⁶ conidia/ml) using sterile needles. The Control were treated with 10 µl of sterile distilled water. All fruits were placed in sterile plastic containers and incubated at 25 ± 1°C, 90% relative humidity, and a 12-hour light cycle. This experime
{"title":"First Report of <i>Neoscytalidium dimidiatum</i> Causing Fruit Rot on Fig in China.","authors":"Pan Xie, Shuaishuai Sha, Hongyue Li, Hanhan Zhai","doi":"10.1094/PDIS-11-24-2349-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-11-24-2349-PDN","url":null,"abstract":"<p><p>Fig (Ficus carica L.) holds economic significance in Atushi, Xinjiang, but as fig cultivation expands, disease prevalence has risen. In July 2024, approximately 22% of harvested fig (cv. Xinjiang Zaohuang) from 20 commercial orchards (covering 40 hectares) in Atushi (39°39'37.65\" N, 76°14'3.62\" E) showed varying degrees of fruit rot symptoms. The initial symptoms were characterized by the appearance of small, brown lesions on the fruit surface. These lesions rapidly progressed into water-soaked spots, which expanded quickly. As the disease advanced, the affected areas became covered with dense, white, fluffy mycelia, accompanied by prominent black sporulation. In later stages, the infected tissues softened further, ultimately resulting in the complete decay of the fruit. Twenty diseased fig were collected from the sampling site. Tissue samples (5×5×5 mm) were cut at the diseased-healthy junction, surface-sterilized in 0.5% NaClO for 1 minute, rinsed twice in sterile distilled water, air-dried, and transferred aseptically onto potato dextrose agar (PDA), and incubated at 25°C for 5 days with a 12-hour photoperiod. Fifteen isolates were obtained from the infected tissues, with two representative isolates (WH 12 and WH 23) selected for further study due to morphological similarity. The fungal colonies initially appeared as white mycelium, later turning olive green to grayish-black. Colony growth was rapid (32 mm/day). Arthrospores were colorless to light brown, short columnar, aseptate, with a truncated base, 0 to 1 septate, averaging 11.9±2.3×3.6±0.8 μm (n = 50), and sometimes formed arthric chains. Chlamydospores were dark brown, round or oval, 0 to 1 septate, averaging 7.26±1.7×5.05±1.0 μm (n = 50). Genomic DNA was extracted from the two isolates. The internal transcribed spacer (ITS), translation elongation factor 1-alpha (TEF1-α), and beta-tubulin (TUB2) genes were amplified using primers ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone & Kohn. 1999), and BT2a/BT2b (Glass & Donaldson. 1995), respectively, and sequences were deposited in GenBank (ITS: PQ555020, PQ555021; TUB2: PQ557519, PQ557521; TEF1-α: PQ557520, PQ557522). BLAST analysis revealed 99-100% similarity to Neoscytalidium dimidiatum Arp2-D (ITS: MK813852; TUB2: MK816354; TEF1-α: MK816355). Phylogenetic analysis using IQ-Tree and MrBayes3.2.7 based on concatenated ITS-TEF1-TUB sequences showed WH 12 and WH 23 clustering with N. dimidiatum Arp2-D (99% bootstrap). Morphological and molecular data identified the isolates as N. dimidiatum (Penz.) Crous & Slippers (Crous et al. 2006). Pathogenicity tests were conducted on 20 healthy fig (cv. Xinjiang Zaohuang) by inoculating each fruit with 10 µl of a WH 12 conidial suspension (1 × 10⁶ conidia/ml) using sterile needles. The Control were treated with 10 µl of sterile distilled water. All fruits were placed in sterile plastic containers and incubated at 25 ± 1°C, 90% relative humidity, and a 12-hour light cycle. This experime","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143060160","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2025-01-28DOI: 10.1094/PDIS-09-24-2014-PDN
Sheng Jun Xu, Zhuo Qiong Jing, Zhi Jie Guo
<p><p>Astragalus mongholicus is a perennial Chinese medicinal herb in the family Leguminosae widely cultivated in China. In September 2023, A. mongholicus plants in a field in Weiyuan County, Gansu Province, showed symptoms of circular or irregular brown, sunken and necrotic lesions, multiple lesions coalesced, and brown longitudinal cracks in the roots. An investigation was performed in a 1998 m2 field with a root rot incidence of 10%, and the severity ranged from 5 to 60% of root surface area. Five rotted root samples were collected. Fragments of symptomatic roots were surface sterilized with 75% ethanol for 10 s, 2% sodium hypochlorite for 2 min, washed three times with sterilized distilled water, and then blotted dry on sterile filter paper. Fragments were placed on potato dextrose agar (PDA) medium and incubated at 25 ± 1°C in darkness for 5 days and five isolates were purified by transferring single hyphal tips to new PDA plates. Isolates WY23AM01 and WY23AM05, two of five isolates with similar morphology, were randomly selected for morphological and molecular identification and pathogenicity tests. Colonies of the fungus were white initially, then turned light brown to brown, raised, and with entire or undulate edges. Sclerotia were brown and produced on PDA after 20 days of incubation at 25 ± 1°C in the dark. Genomic DNA from each of the two isolates was extracted, and the internal transcribed spacer (ITS) region was amplified and sequenced with the primer pair ITS5/ITS4 (White et al. 1990). The sequences of isolates WY23AM01 and WY23AM05 were deposited in GenBank (PQ362092 and PQ362093). Phylogenetic analyses were performed by the maximum likelihood method with ITS sequences for anastomosis groups (AG) of Rhizoctonia solani using MEGA 10.0. The phylogenetic tree grouped the two isolates within the R. solani AG-5 clade with high bootstrap support (99%). PCR analysis was performed with 21 primers specifically designed to detect individual anastomosis groups or anastomosis subgroups of R. solani (Carling et al., 2002; Misawa and Kurose, 2019; Misawa et al., 2020; Okubara et al., 2008). Among the 21 specific primer pairs, only AG-5 specific primer amplified the fungal DNA, indicating that the two isolates belonged to the R. solani AG-5. For pathogenicity tests, two isolates were grown individually on sterile wheat kernels at 25 ± 1°C for 10 days. Certified pathogen-free seedling stage roots were grown in the plastic pot filled with the commercially available sterilized horticultural soil and inoculated by burying twenty infested wheat kernels in the soil adjacent to the roots. Control plants were inoculated with sterile wheat kernels using the same procedure. Each pot had three roots, and each treatment had 12 pots as replicates. All plants were placed in a greenhouse with 60% relative humidity and a 12h/12h light/dark photoperiod at 15 to 30°C. Sixty days after inoculation, typical root rot symptoms developed on all inoculated plants, simil
{"title":"Occurrence of <i>Rhizoctonia solani</i> AG-5 Causing Root Rot on <i>Astragalus mongholicus</i> in Northwestern China.","authors":"Sheng Jun Xu, Zhuo Qiong Jing, Zhi Jie Guo","doi":"10.1094/PDIS-09-24-2014-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-09-24-2014-PDN","url":null,"abstract":"<p><p>Astragalus mongholicus is a perennial Chinese medicinal herb in the family Leguminosae widely cultivated in China. In September 2023, A. mongholicus plants in a field in Weiyuan County, Gansu Province, showed symptoms of circular or irregular brown, sunken and necrotic lesions, multiple lesions coalesced, and brown longitudinal cracks in the roots. An investigation was performed in a 1998 m2 field with a root rot incidence of 10%, and the severity ranged from 5 to 60% of root surface area. Five rotted root samples were collected. Fragments of symptomatic roots were surface sterilized with 75% ethanol for 10 s, 2% sodium hypochlorite for 2 min, washed three times with sterilized distilled water, and then blotted dry on sterile filter paper. Fragments were placed on potato dextrose agar (PDA) medium and incubated at 25 ± 1°C in darkness for 5 days and five isolates were purified by transferring single hyphal tips to new PDA plates. Isolates WY23AM01 and WY23AM05, two of five isolates with similar morphology, were randomly selected for morphological and molecular identification and pathogenicity tests. Colonies of the fungus were white initially, then turned light brown to brown, raised, and with entire or undulate edges. Sclerotia were brown and produced on PDA after 20 days of incubation at 25 ± 1°C in the dark. Genomic DNA from each of the two isolates was extracted, and the internal transcribed spacer (ITS) region was amplified and sequenced with the primer pair ITS5/ITS4 (White et al. 1990). The sequences of isolates WY23AM01 and WY23AM05 were deposited in GenBank (PQ362092 and PQ362093). Phylogenetic analyses were performed by the maximum likelihood method with ITS sequences for anastomosis groups (AG) of Rhizoctonia solani using MEGA 10.0. The phylogenetic tree grouped the two isolates within the R. solani AG-5 clade with high bootstrap support (99%). PCR analysis was performed with 21 primers specifically designed to detect individual anastomosis groups or anastomosis subgroups of R. solani (Carling et al., 2002; Misawa and Kurose, 2019; Misawa et al., 2020; Okubara et al., 2008). Among the 21 specific primer pairs, only AG-5 specific primer amplified the fungal DNA, indicating that the two isolates belonged to the R. solani AG-5. For pathogenicity tests, two isolates were grown individually on sterile wheat kernels at 25 ± 1°C for 10 days. Certified pathogen-free seedling stage roots were grown in the plastic pot filled with the commercially available sterilized horticultural soil and inoculated by burying twenty infested wheat kernels in the soil adjacent to the roots. Control plants were inoculated with sterile wheat kernels using the same procedure. Each pot had three roots, and each treatment had 12 pots as replicates. All plants were placed in a greenhouse with 60% relative humidity and a 12h/12h light/dark photoperiod at 15 to 30°C. Sixty days after inoculation, typical root rot symptoms developed on all inoculated plants, simil","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143060261","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
<p><p>Katsumada galangal seed (<i>Alpinia hainanensis</i> K. Schum) is an important member of the Zingiberaceae family, with both medicinal value and culinary applications (Park et al. 2020). In May 2023, a stem disease of <i>Al. hainanensis</i> was detected in a 100-acre plantation located in Danzhou City, Hainan Province in China, with an average incidence of 15% to 20%. The disease primarily targeted the basal stems, with the pathogen spreading by mycelia in the soil around the rhizome, and reaching neighboring plants. The infection caused the stem base to undergo necrosis, turning the tissue brown to black, and leading to a loosely attached epidermis. As the disease advanced, the necrosis progressed upward along the stem, resulting in curling of the leaves. A large number of white mycelia, as well as white immature sclerotia and brown mature sclerotia, were also observed on the surfaces of the leaves, stems and soil. The diameter of the mature sclerotia ranged from 0.7 to 1.6 mm (aver. ± SD = 1.2 ± 0.3 mm, <i>n</i> = 50). To identify the pathogen, eleven tissue samples were collected from symptomatic stems. The sclerotia on the surface of the tissue were sterilized with 75% (V/V) ethanol for 30 s, followed by three rinses with sterile water, and finally incubated on potato dextrose agar (PDA) at 28°C in darkness. Eleven isolates were obtained and subcultured at 28°C in darkness. After 48 hours, the colonies of these isolates had an average daily radial growth of 39.5 ± 0.4 mm (<i>n</i> = 11) and were white, featuring entire margins and abundant aerial mycelia. By the seventh day, spherical or oval white sclerotia began to form on the surface of their colonies. These sclerotia eventually turned brown, with a diameter ranging from 0.6 to 1.5 mm (aver. ± SD = 1.3 ± 0.3 mm, <i>n</i> = 50). The morphological characteristics of these isolates were similar to those of <i>Agroathelia rolfsii</i> (Sacc.) Redhead & Mullineux (basionym: <i>Sclerotium rolfsii</i> Sacc.; Amylocorticiaceae) (Redhead and Mullineux 2023). DNA of a representative isolate DZAS-01 was extracted for amplification of its internal transcribed spacer (ITS) rDNA region, the translation elongation factor 1-alpha (<i>TEF1</i>) gene and the large subunit (LSU) region using the primers ITS1/ITS4, EF1-983F/EF1-2218R and LROR/LR5, respectively (Moncalvo et al. 2000, Rehner and Buckley 2005, White et al. 1990). The three sequences have been deposited in GenBank (accession nos. PP659527 for ITS, 607 bp; PP976301 for <i>TEF1</i>, 1,040 bp; PP968104 for LSU, 876 bp). The BLASTn results showed that the similarity of the three sequences with the known sequences PP908473 (ITS), OL416131 (<i>TEF1</i>) and KY446370 (LSU) of <i>Ag. rolfsii</i> was 100%, 99.81% and 100%, respectively. Pathogenicity tests were conducted on ten potted, 6-week-old healthy <i>Al. hainanensis</i> plants. The stem bases of ten plants were wounded with sterile needles and divided into two groups with five plants in each gr
{"title":"First Report of <i>Agroathelia rolfsii</i> Causing Southern Blight on <i>Alpinia hainanensis</i> in China.","authors":"Chao Zhang, Yaru Guo, Peixin Luo, Changping Xie, Li Zheng, Daipeng Chen","doi":"10.1094/PDIS-07-24-1453-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-07-24-1453-PDN","url":null,"abstract":"<p><p>Katsumada galangal seed (<i>Alpinia hainanensis</i> K. Schum) is an important member of the Zingiberaceae family, with both medicinal value and culinary applications (Park et al. 2020). In May 2023, a stem disease of <i>Al. hainanensis</i> was detected in a 100-acre plantation located in Danzhou City, Hainan Province in China, with an average incidence of 15% to 20%. The disease primarily targeted the basal stems, with the pathogen spreading by mycelia in the soil around the rhizome, and reaching neighboring plants. The infection caused the stem base to undergo necrosis, turning the tissue brown to black, and leading to a loosely attached epidermis. As the disease advanced, the necrosis progressed upward along the stem, resulting in curling of the leaves. A large number of white mycelia, as well as white immature sclerotia and brown mature sclerotia, were also observed on the surfaces of the leaves, stems and soil. The diameter of the mature sclerotia ranged from 0.7 to 1.6 mm (aver. ± SD = 1.2 ± 0.3 mm, <i>n</i> = 50). To identify the pathogen, eleven tissue samples were collected from symptomatic stems. The sclerotia on the surface of the tissue were sterilized with 75% (V/V) ethanol for 30 s, followed by three rinses with sterile water, and finally incubated on potato dextrose agar (PDA) at 28°C in darkness. Eleven isolates were obtained and subcultured at 28°C in darkness. After 48 hours, the colonies of these isolates had an average daily radial growth of 39.5 ± 0.4 mm (<i>n</i> = 11) and were white, featuring entire margins and abundant aerial mycelia. By the seventh day, spherical or oval white sclerotia began to form on the surface of their colonies. These sclerotia eventually turned brown, with a diameter ranging from 0.6 to 1.5 mm (aver. ± SD = 1.3 ± 0.3 mm, <i>n</i> = 50). The morphological characteristics of these isolates were similar to those of <i>Agroathelia rolfsii</i> (Sacc.) Redhead & Mullineux (basionym: <i>Sclerotium rolfsii</i> Sacc.; Amylocorticiaceae) (Redhead and Mullineux 2023). DNA of a representative isolate DZAS-01 was extracted for amplification of its internal transcribed spacer (ITS) rDNA region, the translation elongation factor 1-alpha (<i>TEF1</i>) gene and the large subunit (LSU) region using the primers ITS1/ITS4, EF1-983F/EF1-2218R and LROR/LR5, respectively (Moncalvo et al. 2000, Rehner and Buckley 2005, White et al. 1990). The three sequences have been deposited in GenBank (accession nos. PP659527 for ITS, 607 bp; PP976301 for <i>TEF1</i>, 1,040 bp; PP968104 for LSU, 876 bp). The BLASTn results showed that the similarity of the three sequences with the known sequences PP908473 (ITS), OL416131 (<i>TEF1</i>) and KY446370 (LSU) of <i>Ag. rolfsii</i> was 100%, 99.81% and 100%, respectively. Pathogenicity tests were conducted on ten potted, 6-week-old healthy <i>Al. hainanensis</i> plants. The stem bases of ten plants were wounded with sterile needles and divided into two groups with five plants in each gr","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143060151","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2025-01-28DOI: 10.1094/PDIS-08-24-1731-PDN
Jobelle Bruno, Inderjit Barphagha, John Ontoy, Felipe Dalla Lana, Jong Hyun Ham
<p><p>In July 2023, panicle and leaf blight-like symptoms were observed from the rice (<i>Oryza sativa</i>) variety, PVL03, in research field plots in Louisiana (Rayne, LA 70578, USA; 30.21330⁰ N, 92.37309⁰ W). We observed that chlorosis started on the tips and spread throughout the whole leaf. We also observed panicle blight-like symptoms (grain discoloration of rice hulls) on infected rice plants at the heading stage, which ranged from dark brown to black. Disease incidences were approximately 70% in the observed plots. Five plants were sampled from five plots (one plant per plot). Leaf tissues including both symptomatic and healthy parts (~ 1 cm<sup>2</sup>) were surfaced sterilized and placed on CCNT medium, a semi-selective medium for the rice bacterial panicle blight pathogen <i>Burkholderia glumae</i> (Kawaradani et al., 2000), and on Luria-Bertani (LB) agar supplemented with cycloheximide (50 µg/ml) for non-selective isolation of bacteria. For the panicle samples, the surfaced sterilized rice kernels were dehulled and ground in sterile distilled H<sub>2</sub>O using a sterile mortar and pestle. The homogenate was spread on the CCNT media and LB agar supplemented with nitrofurantoin (50 µg/ml) and cycloheximide (50 µg/ml). After ~72 h at 41⁰C, round, smooth and yellow-colored bacterial colonies were observed on both media. The two isolates, one from an infected rice leaf (LPL-1) and the other from the infected rice panicles (LPP-1), were initially identified as Pantoea ananatis based on PCR-amplified 16S rDNA sequences (Weisburg et al., 1991). The taxonomic identity of these two isolates was further confirmed through whole genome sequencing (NCBI Accession ID: PRJNA1092676), which was performed through a hybrid sequencing approach using Oxford Nanopore sequencer & Illumina NextSeq2000 system (Plasmidsaurus Inc., South San Francisco, CA, USA). To satisfy Koch's postulates, we inoculated six one-month-old rice plants (cv. Kitaake) with LPL-1 and LPP-1, respectively, by pricking the stems with a sterile toothpick touched to the overnight grown bacterial culture on LB agar (~ 5-8 x 10<sup>5</sup> bacterial cells). This virulence assay was conducted twice, and rice plants inoculated with sterile distilled water were included as the negative control. By 27 days post inoculation (DPI), the inoculated plants developed symptoms on leaves and panicles, which were like the symptoms originally observed in the field, and additional symptoms such as shot holes and stem necrosis were also observed. From leaf and panicle samples of the artificially inoculated plants, we reisolated bacteria and confirmed the identity of the bacteria using the P. ananatis specific PCR primers PANA_1080 61F and PANA_1080 1009R (Asselin et al., 2016). To the best of our knowledge, this is the first report of bacterial panicle and leaf blight of rice caused by <i>P. ananatis</i> in Louisiana. Since <i>P. ananatis</i> is a recently emerging pathogen of rice worldwide, including
{"title":"First Report of <i>Pantoea ananatis</i> Causing Bacterial Leaf and Panicle Blight of Rice in Louisiana, USA.","authors":"Jobelle Bruno, Inderjit Barphagha, John Ontoy, Felipe Dalla Lana, Jong Hyun Ham","doi":"10.1094/PDIS-08-24-1731-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-08-24-1731-PDN","url":null,"abstract":"<p><p>In July 2023, panicle and leaf blight-like symptoms were observed from the rice (<i>Oryza sativa</i>) variety, PVL03, in research field plots in Louisiana (Rayne, LA 70578, USA; 30.21330⁰ N, 92.37309⁰ W). We observed that chlorosis started on the tips and spread throughout the whole leaf. We also observed panicle blight-like symptoms (grain discoloration of rice hulls) on infected rice plants at the heading stage, which ranged from dark brown to black. Disease incidences were approximately 70% in the observed plots. Five plants were sampled from five plots (one plant per plot). Leaf tissues including both symptomatic and healthy parts (~ 1 cm<sup>2</sup>) were surfaced sterilized and placed on CCNT medium, a semi-selective medium for the rice bacterial panicle blight pathogen <i>Burkholderia glumae</i> (Kawaradani et al., 2000), and on Luria-Bertani (LB) agar supplemented with cycloheximide (50 µg/ml) for non-selective isolation of bacteria. For the panicle samples, the surfaced sterilized rice kernels were dehulled and ground in sterile distilled H<sub>2</sub>O using a sterile mortar and pestle. The homogenate was spread on the CCNT media and LB agar supplemented with nitrofurantoin (50 µg/ml) and cycloheximide (50 µg/ml). After ~72 h at 41⁰C, round, smooth and yellow-colored bacterial colonies were observed on both media. The two isolates, one from an infected rice leaf (LPL-1) and the other from the infected rice panicles (LPP-1), were initially identified as Pantoea ananatis based on PCR-amplified 16S rDNA sequences (Weisburg et al., 1991). The taxonomic identity of these two isolates was further confirmed through whole genome sequencing (NCBI Accession ID: PRJNA1092676), which was performed through a hybrid sequencing approach using Oxford Nanopore sequencer & Illumina NextSeq2000 system (Plasmidsaurus Inc., South San Francisco, CA, USA). To satisfy Koch's postulates, we inoculated six one-month-old rice plants (cv. Kitaake) with LPL-1 and LPP-1, respectively, by pricking the stems with a sterile toothpick touched to the overnight grown bacterial culture on LB agar (~ 5-8 x 10<sup>5</sup> bacterial cells). This virulence assay was conducted twice, and rice plants inoculated with sterile distilled water were included as the negative control. By 27 days post inoculation (DPI), the inoculated plants developed symptoms on leaves and panicles, which were like the symptoms originally observed in the field, and additional symptoms such as shot holes and stem necrosis were also observed. From leaf and panicle samples of the artificially inoculated plants, we reisolated bacteria and confirmed the identity of the bacteria using the P. ananatis specific PCR primers PANA_1080 61F and PANA_1080 1009R (Asselin et al., 2016). To the best of our knowledge, this is the first report of bacterial panicle and leaf blight of rice caused by <i>P. ananatis</i> in Louisiana. Since <i>P. ananatis</i> is a recently emerging pathogen of rice worldwide, including","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143060247","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
<p><p>Strawberry (<i>Fragaria × ananassa</i>) is an important economic crop in Hebei, China. In May 2023, root rot was observed in strawberry plantations (cultivar 'Benihoppe') in Shijiazhuang (37°57'23″N, 115°16'34″E), Hebei, China. The incidence of the disease reached up to 30% in the field. The infected plants displayed symptoms of reduced vigor and stunted growth, yellowing leaves, blackened roots, and eventual rotting. Ten diseased strawberry plants were collected for pathogen isolation. Root tissues of symptomatic plants were surface sterilized sequentially in 70% ethanol (1 min), 3.125% NaOCl (6 min), and 70% ethanol (30 s), then they were rinsed in sterile water three times (Sahu et al. 2022). The sterilized roots were then cut into 3.0 × 3.0 mm pieces and placed on potato dextrose agar (PDA) medium supplemented with chloramphenicol (100 μg/mL). After 2 to 3 days incubated at 25℃ in darkness, single colonies from the initial isolates were streaked onto PDA agar plates to obtain pure cultures. The fungal colonies appeared milky white on PDA medium and exhibited only hyphae growth. Globose perithecia were observed on V8-juice medium after 30 days of incubation, with black, smooth, spherical ascospores 13.9 to 19.1 μm in diameter (n=50). For molecular analysis, the representative isolates ME10-2 and ME10-3 from different strawberry plants were selected for the amplification of internal transcribed spacer (ITS) and elongation factor 1-alpha (<i>EF</i>-1α) sequences using the primer sets ITS1/ITS4 (Bellemain et al. 2010) and EF1-688F/EF1-1251R (Alves et al. 2008). The sequences were deposited in GenBank (accession no. PP990210 and PP990211 for ITS, and PQ001579 and PQ001580 for <i>EF</i>-1α). BLASTn analysis revealed that the sequences of ITS had above 99% (504/511 bp and 503/506 bp) similarity to <i>Monosporascus eutypoides</i> (MK183805.1), the sequences of <i>EF</i>-1α had 94% (625/661 bp and 619/656 bp) similarity to <i>Monosporascus eutypoides</i> (JQ958959.1). Phylogenetic analysis based on concatenated sequences of ITS and <i>EF</i>-1α using the Maximum Likelihood method with IQ-TREE version 2.2.3 (Nguyen et al. 2015) also indicated that the two isolates clustered with <i>M. eutypoides</i>. To fulfill Koch's postulates, pathogenicity tests were performed (Chen et al. 2024). Due to challenges in ascospore production, an improved wheat grain medium (wheat grain with 2% dextrose) was used for fungal culture (Sainos et al. 2006). After 14 days of inoculation at 25℃, the medium was crushed and mixed into sterilized soil with a 10% ratio by weight. Four-week-old strawberry plants were transplanted into the inoculated soil and grown in a growth chamber at 25℃ (16 h light/8 h dark). Strawberry plants transplanted into sterilized uninoculated soil served as a negative control. Three weeks post-inoculation, the inoculated strawberry plants exhibited symptoms similar to those observed in field-infected, whereas no symptoms were observed on the con
{"title":"First report of strawberry root rot caused by <i>Monosporascus eutypoides</i> in China.","authors":"Jiaqi Zhang, Lihong Dong, Yifan Fu, Qinggang Guo, Peipei Wang, Ping Ma","doi":"10.1094/PDIS-07-24-1465-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-07-24-1465-PDN","url":null,"abstract":"<p><p>Strawberry (<i>Fragaria × ananassa</i>) is an important economic crop in Hebei, China. In May 2023, root rot was observed in strawberry plantations (cultivar 'Benihoppe') in Shijiazhuang (37°57'23″N, 115°16'34″E), Hebei, China. The incidence of the disease reached up to 30% in the field. The infected plants displayed symptoms of reduced vigor and stunted growth, yellowing leaves, blackened roots, and eventual rotting. Ten diseased strawberry plants were collected for pathogen isolation. Root tissues of symptomatic plants were surface sterilized sequentially in 70% ethanol (1 min), 3.125% NaOCl (6 min), and 70% ethanol (30 s), then they were rinsed in sterile water three times (Sahu et al. 2022). The sterilized roots were then cut into 3.0 × 3.0 mm pieces and placed on potato dextrose agar (PDA) medium supplemented with chloramphenicol (100 μg/mL). After 2 to 3 days incubated at 25℃ in darkness, single colonies from the initial isolates were streaked onto PDA agar plates to obtain pure cultures. The fungal colonies appeared milky white on PDA medium and exhibited only hyphae growth. Globose perithecia were observed on V8-juice medium after 30 days of incubation, with black, smooth, spherical ascospores 13.9 to 19.1 μm in diameter (n=50). For molecular analysis, the representative isolates ME10-2 and ME10-3 from different strawberry plants were selected for the amplification of internal transcribed spacer (ITS) and elongation factor 1-alpha (<i>EF</i>-1α) sequences using the primer sets ITS1/ITS4 (Bellemain et al. 2010) and EF1-688F/EF1-1251R (Alves et al. 2008). The sequences were deposited in GenBank (accession no. PP990210 and PP990211 for ITS, and PQ001579 and PQ001580 for <i>EF</i>-1α). BLASTn analysis revealed that the sequences of ITS had above 99% (504/511 bp and 503/506 bp) similarity to <i>Monosporascus eutypoides</i> (MK183805.1), the sequences of <i>EF</i>-1α had 94% (625/661 bp and 619/656 bp) similarity to <i>Monosporascus eutypoides</i> (JQ958959.1). Phylogenetic analysis based on concatenated sequences of ITS and <i>EF</i>-1α using the Maximum Likelihood method with IQ-TREE version 2.2.3 (Nguyen et al. 2015) also indicated that the two isolates clustered with <i>M. eutypoides</i>. To fulfill Koch's postulates, pathogenicity tests were performed (Chen et al. 2024). Due to challenges in ascospore production, an improved wheat grain medium (wheat grain with 2% dextrose) was used for fungal culture (Sainos et al. 2006). After 14 days of inoculation at 25℃, the medium was crushed and mixed into sterilized soil with a 10% ratio by weight. Four-week-old strawberry plants were transplanted into the inoculated soil and grown in a growth chamber at 25℃ (16 h light/8 h dark). Strawberry plants transplanted into sterilized uninoculated soil served as a negative control. Three weeks post-inoculation, the inoculated strawberry plants exhibited symptoms similar to those observed in field-infected, whereas no symptoms were observed on the con","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143060256","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2025-01-28DOI: 10.1094/PDIS-12-24-2696-PDN
Chantal Faure, Armelle Marais, Thierry Candresse
<p><p>Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the associat
{"title":"First report of privet leaf blotch-associated virus (PLBaV) infecting lilac (<i>Syringa vulgaris</i> L.) in France.","authors":"Chantal Faure, Armelle Marais, Thierry Candresse","doi":"10.1094/PDIS-12-24-2696-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-12-24-2696-PDN","url":null,"abstract":"<p><p>Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the associat","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143060253","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2025-01-28DOI: 10.1094/PDIS-05-24-1044-PDN
Camila Salinas, Ysadora Fernández, Alan Zamorano, Sara Zapata, Claudio Osorio-Navarro, Jose Luis Henriquez
<p><p>Walnut (Juglans regia L.) is the primary nut tree cultivated in Chile, covering 44.626 ha. In autumn 2021, walnut decline and tree mortality were observed in young and old orchards (two and 18-years-old, respectively) in the O´Higgins Region in the Chilean Central Valley. In the surveyed walnut orchards cv. Chandler (n = 2), the incidence of symptomatic plants ranged from 35 to more than 90 %. Affected trees showed poor growth, twig and branch death, early defoliation, and shoot dieback. In addition, collar base necrosis and root rot were observed in symptomatic trees, resembling the symptoms of black foot disease, with blackening of complete roots and even the entire root system. Symptomatic root tissues from 5 independent trees were cut into pieces of about 25 mm2. The samples were sterilized for three minutes in a sodium hypochlorite solution (1%), rinsed in sterile distilled water, and plated onto Potato Dextrose Agar (PDA) medium supplemented with lactic acid (10%) and 0.5 g/L of streptomycin sulfate. Mycelium grew from the samples after seven days of incubation at 24°C. The characteristics of the culture and morphology of conidiophores and conidia indicated a Cylindrocarpon-like fungus. Then, 5 single-conidial isolates were obtained and subsequently grown on a PDA medium. Genomic DNA was extracted from cultures of three representative isolates (CNCO5; CNCO6; CNSF2) and used for amplification and sequencing of the Internal Transcribed Spacer of rDNA (ITS), β-tubulin (TUB2), Histone3 (HIS3), and Translation Elongation Factor 1-alpha (TEF1-α) partial gene regions using the primers ITS1/ITS4 (White et al. 1990), T1/Bt2b (O'Donnell and Cigelnik 1997; Glass and Donaldson 1995), CYLH3F/CYLH3R (Crous et al. 2004), and EF1-728F/EF1-986R (Carbone and Kohn 1999), respectively. Isolates clustered consistently with Ilyonectria liriodendri after a multilocus molecular phylogenetic analysis. Sequences were deposited in at NCBI Genbank data base (ITS: OR871536-OR871537-OR871538, TUB2: PP780828-PP780829-PP780830, HIS3: PP780822-PP780823-PP780824, and TEF1-α: PP780825-PP780826-PP780827). A pathogenicity test was conducted by inoculating three walnut Vlach rootstocks (six months old) with one representative I. liriodendri isolate (CNCO6). Plant roots were cut 5 cm from the root tip and immersed in a 105/mL conidial suspension for 30 min; control plants were immersed in sterile distilled water. Then, the plants were transplanted to a sterile substrate. After six weeks of growing in a greenhouse, necrosis characterized by brown-black coloration of the roots was observed developing upwards from the wounded roots. Necrotic lesions were found even in secondary roots of infected plants; however, control plants remained asymptomatic. The fungus was re-isolated, completing Koch's postulates. Black foot disease caused by Ilyonectria spp. has been reported worldwide on grapevines (Ye et al., 2021) and causing root rot of other fruit trees such as olive (Úrbez-Tor
{"title":"First report of <i>Ilyonectria liriodendri</i> causing black foot on walnut in Chile.","authors":"Camila Salinas, Ysadora Fernández, Alan Zamorano, Sara Zapata, Claudio Osorio-Navarro, Jose Luis Henriquez","doi":"10.1094/PDIS-05-24-1044-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-05-24-1044-PDN","url":null,"abstract":"<p><p>Walnut (Juglans regia L.) is the primary nut tree cultivated in Chile, covering 44.626 ha. In autumn 2021, walnut decline and tree mortality were observed in young and old orchards (two and 18-years-old, respectively) in the O´Higgins Region in the Chilean Central Valley. In the surveyed walnut orchards cv. Chandler (n = 2), the incidence of symptomatic plants ranged from 35 to more than 90 %. Affected trees showed poor growth, twig and branch death, early defoliation, and shoot dieback. In addition, collar base necrosis and root rot were observed in symptomatic trees, resembling the symptoms of black foot disease, with blackening of complete roots and even the entire root system. Symptomatic root tissues from 5 independent trees were cut into pieces of about 25 mm2. The samples were sterilized for three minutes in a sodium hypochlorite solution (1%), rinsed in sterile distilled water, and plated onto Potato Dextrose Agar (PDA) medium supplemented with lactic acid (10%) and 0.5 g/L of streptomycin sulfate. Mycelium grew from the samples after seven days of incubation at 24°C. The characteristics of the culture and morphology of conidiophores and conidia indicated a Cylindrocarpon-like fungus. Then, 5 single-conidial isolates were obtained and subsequently grown on a PDA medium. Genomic DNA was extracted from cultures of three representative isolates (CNCO5; CNCO6; CNSF2) and used for amplification and sequencing of the Internal Transcribed Spacer of rDNA (ITS), β-tubulin (TUB2), Histone3 (HIS3), and Translation Elongation Factor 1-alpha (TEF1-α) partial gene regions using the primers ITS1/ITS4 (White et al. 1990), T1/Bt2b (O'Donnell and Cigelnik 1997; Glass and Donaldson 1995), CYLH3F/CYLH3R (Crous et al. 2004), and EF1-728F/EF1-986R (Carbone and Kohn 1999), respectively. Isolates clustered consistently with Ilyonectria liriodendri after a multilocus molecular phylogenetic analysis. Sequences were deposited in at NCBI Genbank data base (ITS: OR871536-OR871537-OR871538, TUB2: PP780828-PP780829-PP780830, HIS3: PP780822-PP780823-PP780824, and TEF1-α: PP780825-PP780826-PP780827). A pathogenicity test was conducted by inoculating three walnut Vlach rootstocks (six months old) with one representative I. liriodendri isolate (CNCO6). Plant roots were cut 5 cm from the root tip and immersed in a 105/mL conidial suspension for 30 min; control plants were immersed in sterile distilled water. Then, the plants were transplanted to a sterile substrate. After six weeks of growing in a greenhouse, necrosis characterized by brown-black coloration of the roots was observed developing upwards from the wounded roots. Necrotic lesions were found even in secondary roots of infected plants; however, control plants remained asymptomatic. The fungus was re-isolated, completing Koch's postulates. Black foot disease caused by Ilyonectria spp. has been reported worldwide on grapevines (Ye et al., 2021) and causing root rot of other fruit trees such as olive (Úrbez-Tor","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143060157","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2025-01-28DOI: 10.1094/PDIS-10-24-2193-PDN
Qianqian Zhou, Liping Chen, Hongxia Zheng, Yi Zhang, Lei Zhou, Mingfei Xu
<p><p>Chinese yam (<i>Dioscorea polystachya</i> Turcz.), known for its nutrient-rich underground tubers, is both a food source and a traditional Chinese medicinal plant. It offers significant nutritional and medicinal benefits. In 2023, the cultivation of Chinese yam, specifically the Wencheng Waxy Yam variety, exceeded 400 hectares in Wencheng County, Zhejiang Province, China, with an annual yield surpassing 9,000 tons (Chen et al. 2024). This crop has become a vital industry for local farmers in mountainous areas. In July 2023, a black leaf spot disease was detected in the Wencheng County Chinese Yam planting base on almost 21 hectares (Huangyang Village, Huangtan Town, 120.09°E, 27.79°N). The disease affected between 70% and 85% of the plant area, with symptomatic leaves constituting 45% of the total leaf count. Initially, black spots appeared on the leaves, which later expanded into dark brown spots with yellowing of the edges. In severe cases, the centers of the spots became necrotic. To investigate the nature of the pathogen, eight symptomatic leaves were randomly collected, cut into small pieces (about 0.3 cm × 0.3 cm), and subjected to a series of treatments: soaking in 75% ethanol for 1 minute, followed by 5 minutes in 2% sodium hypochlorite, and finally washed three times with sterile distilled water. The pieces were then dried on sterile filter paper and incubated on potato dextrose agar (PDA) at 28°C under a 12-hour light/dark cycle. After 5 days, mycelial edges were transferred to fresh PDA plates for future purification. Finally, five pure colonies with consistent morphology were obtained through repeated separations. When cultured on PDA for 7 days, colonies exhibited gray-white aerial hyphae on the front and brown on the back. Pycnidia were dark, mostly spheroid, and measured 44.5 to 81.2 × 66.9 to 107.3 µm (n = 20). Chlamydospores were nearly spherical, either unicellular or multicellular, and measured 7.16 to 10.35 × 15.82 to 28.92 μm (n = 30). While conidia were ellipsoidal, single-celled, aseptate, and ranged from 1.8 to 3.5 × 3.6 to 6.9 μm (n = 30). Genomic DNA from fresh colonies was extracted using the DNA Secure Plant Kit (Tiangen Biotech, Beijing, China). Polymerase chain reaction (PCR) amplification was carried out using standard primers and procedures for the rDNA internal transcribed spacer (<i>ITS</i>), β-tubulin (<i>TUB</i>), and actin (<i>ACT</i>). Sequences were amplified and sequenced with primers <i>ITS1/ITS4</i> (White et al. 1990), <i>Bt2a/Bt2b</i> (Glass and Donaldson 1995), and <i>ACT512F/ACT783R</i> (Carbone and Kohn 1999), respectively. These sequences were deposited in GenBank under accession numbers PQ197602 (<i>ITS</i>), PQ201634 (<i>TUB</i>), and PQ201635 (<i>ACT</i>). BLAST analysis revealed 100% identity with <i>Epicoccum sorghinum</i> (MT125854 (544/544 bp), OP555979 (344/344 bp), MK044832 (274/274 bp), respectively). A phylogenetic tree constructed using the Maximum Likelihood method in MEGA6 confir
{"title":"First Report of <i>Epicoccum sorghinum</i> Causing Black Leaf Spot on <i>Dioscorea polystachya</i> in China.","authors":"Qianqian Zhou, Liping Chen, Hongxia Zheng, Yi Zhang, Lei Zhou, Mingfei Xu","doi":"10.1094/PDIS-10-24-2193-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-10-24-2193-PDN","url":null,"abstract":"<p><p>Chinese yam (<i>Dioscorea polystachya</i> Turcz.), known for its nutrient-rich underground tubers, is both a food source and a traditional Chinese medicinal plant. It offers significant nutritional and medicinal benefits. In 2023, the cultivation of Chinese yam, specifically the Wencheng Waxy Yam variety, exceeded 400 hectares in Wencheng County, Zhejiang Province, China, with an annual yield surpassing 9,000 tons (Chen et al. 2024). This crop has become a vital industry for local farmers in mountainous areas. In July 2023, a black leaf spot disease was detected in the Wencheng County Chinese Yam planting base on almost 21 hectares (Huangyang Village, Huangtan Town, 120.09°E, 27.79°N). The disease affected between 70% and 85% of the plant area, with symptomatic leaves constituting 45% of the total leaf count. Initially, black spots appeared on the leaves, which later expanded into dark brown spots with yellowing of the edges. In severe cases, the centers of the spots became necrotic. To investigate the nature of the pathogen, eight symptomatic leaves were randomly collected, cut into small pieces (about 0.3 cm × 0.3 cm), and subjected to a series of treatments: soaking in 75% ethanol for 1 minute, followed by 5 minutes in 2% sodium hypochlorite, and finally washed three times with sterile distilled water. The pieces were then dried on sterile filter paper and incubated on potato dextrose agar (PDA) at 28°C under a 12-hour light/dark cycle. After 5 days, mycelial edges were transferred to fresh PDA plates for future purification. Finally, five pure colonies with consistent morphology were obtained through repeated separations. When cultured on PDA for 7 days, colonies exhibited gray-white aerial hyphae on the front and brown on the back. Pycnidia were dark, mostly spheroid, and measured 44.5 to 81.2 × 66.9 to 107.3 µm (n = 20). Chlamydospores were nearly spherical, either unicellular or multicellular, and measured 7.16 to 10.35 × 15.82 to 28.92 μm (n = 30). While conidia were ellipsoidal, single-celled, aseptate, and ranged from 1.8 to 3.5 × 3.6 to 6.9 μm (n = 30). Genomic DNA from fresh colonies was extracted using the DNA Secure Plant Kit (Tiangen Biotech, Beijing, China). Polymerase chain reaction (PCR) amplification was carried out using standard primers and procedures for the rDNA internal transcribed spacer (<i>ITS</i>), β-tubulin (<i>TUB</i>), and actin (<i>ACT</i>). Sequences were amplified and sequenced with primers <i>ITS1/ITS4</i> (White et al. 1990), <i>Bt2a/Bt2b</i> (Glass and Donaldson 1995), and <i>ACT512F/ACT783R</i> (Carbone and Kohn 1999), respectively. These sequences were deposited in GenBank under accession numbers PQ197602 (<i>ITS</i>), PQ201634 (<i>TUB</i>), and PQ201635 (<i>ACT</i>). BLAST analysis revealed 100% identity with <i>Epicoccum sorghinum</i> (MT125854 (544/544 bp), OP555979 (344/344 bp), MK044832 (274/274 bp), respectively). A phylogenetic tree constructed using the Maximum Likelihood method in MEGA6 confir","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-01-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143060154","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
京公网安备 11010802042870号
京ICP备2023020795号-1
扫码关注我们
求助内容：
应助结果提醒方式：