M. Z. Nasrullah, T. Neamtalllah, M. Alshibani, et al., “Caffeic Acid Phenethyl Ester Ameliorates Colistin-Induced Nephrotoxicity in Rats via Modulation of FOXO1/Nrf2/Sirt1 Axis,” Clinical and Experimental Pharmacology and Physiology 51, no. 12 (2024): e70000, https://doi.org/10.1111/1440-1681.70000.
In Table 2, the forward sequence of β-Actin 5′AAAGCACATCCAATAAAAAGC was incorrect.
It should be corrected to the following: 5′TCCGTCGCCGGTCCACACCC.
In the abstract, under the methods, ‘group 3 received Cst IP’ is incomplete. It should be corrected to ‘group 3 received Cst (1000 000 IU/Kg) IP’.
The authors apologise for these oversights and for the inconvenience they may have caused.