Journal of molecular graphics & modelling最新文献

Aiming at shedding light on the molecular interactions in deep eutectic solvents (DESs), the DESs based on tetrabutylammonium bromide (TBAB) as hydrogen bond acceptor (HBA) and carboxylic acids (CAs) (formic acid (FA), oxalic acid (OA), and malonic acid (MA)) as hydrogen bond donor (HBD) were investigated by both experimental and theoretical techniques. The thermal behaviors of the prepared DESs were investigated by differential scanning calorimetry (DSC) method. In order to study the hydrogen bond formation between the DESs constituents, the FT-IR analysis was carried out. The large positive deviations of the iso solvent activity lines of ternary HBA + HBD + 2-propanol mixtures determined by the isopiestic technique from the semi-ideal behavior indicate that CAs interact strongly with TBAB and therefore they can form DESs. Molecular dynamics (MD) simulations were performed to present an atomic-scale image of the components and describe the microstructure of DESs. From the MD simulations, the radial distribution functions (RDFs), coordination numbers (CNs), combined distribution functions (CDFs), and spatial distribution functions (SDFs) were calculated to investigate the interaction between the components and three-dimensional visualization of the DESs. The obtained results confirmed the importance of hydrogen bonds in the formation of TBAB/CAs DESs.

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome encodes 29 proteins including four structural, 16 nonstructural (nsps), and nine accessory proteins (https://epimedlab.org/sars-cov-2-proteome/). Many of these proteins contain potential targetable sites for the development of antivirals. Despite the widespread use of vaccinations, the emergence of variants necessitates the investigation of new therapeutics and antivirals. Here, the EpiMed Coronabank Chemical Collection (https://epimedlab.org/crl/) was utilized to investigate potential antivirals against the nsp14 exoribonuclease (ExoN) domain. Molecular docking was performed to evaluate the binding characteristics of our chemical library against the nsp14 ExoN site. Based on the initial screen, trisjuglone, ararobinol, corilagin, and naphthofluorescein were identified as potential lead compounds. Molecular dynamics (MD) simulations were subsequently performed, with the results highlighting the stability of the lead compounds in the nsp14 ExoN site. Protein-RNA docking revealed the potential for the lead compounds to disrupt the interaction with RNA when bound to the ExoN site. Moreover, hypericin, cyanidin-3-O-glucoside, and rutin were previously identified as lead compounds targeting the papain-like protease (PL^pro) naphthalene binding site. Through performing MD simulations, the stability and interactions of lead compounds with PL^pro were further examined. Overall, given the critical role of the exonuclease activity of nsp14 in ensuring viral fidelity and the multifunctional role of PL^pro in viral pathobiology and replication, these nsps represent important targets for antiviral drug development. Our databases can be utilized for in silico studies, such as the ones performed here, and this approach can be applied to other potentially druggable SARS-CoV-2 protein targets.

Elucidating unknown structures of proteins, such as metastable states, is critical in designing therapeutic agents. Protein structure exploration has been performed using advanced computational methods, especially molecular dynamics and Markov chain Monte Carlo simulations, which require untenably long calculation times and prior structural knowledge. Here, we developed an innovative method for protein structure determination called never give up protein exploration (NPEX) with deep reinforcement learning. The NPEX method leverages the soft actor-critic algorithm and the intrinsic reward system, effectively adding a bias potential without the need for prior knowledge. To demonstrate the method's effectiveness, we applied it to four models: a double well, a triple well, the alanine dipeptide, and the tryptophan cage. Compared with Markov chain Monte Carlo simulations, NPEX had markedly greater sampling efficiency. The significantly enhanced computational efficiency and lack of prior domain knowledge requirements of the NPEX method will revolutionize protein structure exploration.

The welding process and the properties of welding instruments may improve the mechanical performance of an item. One of these properties is the length of the welding tool. This approach has a substantial effect on the mechanical strength of the metallic matrix. The current study used molecular dynamics modeling and LAMMPS software to evaluate the effect of welding tool length on the mechanical properties of a welded Cu–Ag metallic matrix. This simulation makes use of the Lennard-Jones potential function and the embedded atom model. First, the equilibrium phase of modeled samples was verified by changing the computation of kinetic and total energies. Next, the mechanical properties of the welded matrix were studied using the stated Young's modulus and ultimate strength. The stress-strain curve of samples demonstrated that the mechanical strength of atomic samples increased as the length of the welding tool (penetration depth) increased. Numerically, by increasing the tool penetration depth of Fe tools from 2 Å to 8 Å, Young's modulus and ultimate strength of the matrixes sample increase from 34.360 GPa to 1390.84 MPa to 38.44 GPa and 1510 MPa, respectively. This suggested that the length of the Fe welding tool significantly affected the mechanical properties of the welded metallic matrix. The longer the length of Fe welding tools, the more particles were involved, and consequently, more bonds were formed among the particles. Bonding among the particles caused changes in mechanical properties, such as greater ultimate strength. This method can optimize mechanical structures and be useful in various industries.

In the current quantum chemical study, indacenodithiophene donor core-based the end-capped alterations of the reference chromophore BTR drafted eight A2-A1-D-A1-A2 type small non-fullerene acceptors. All the computational simulations were executed under MPW1PW91/6-31G (d, p) level of DFT. The UV–Vis absorption, open circuit voltage, electron affinity, ionization potential, the density of states, reorganization energy, orbital analysis, and non-covalent interactions were studied and compared with BTR. Several molecules of our modeled series BT1-BT8 have shown distinctive features that are better than those of the BTR. The open circuit voltage (V_OC) of BT5 has a favorable impact, allowing it to replace BTR in the field of organic solar cells. The charge carrier motilities for proposed molecules generated extraordinary findings when matched to the reference one (BTR). Further charge transmission was confirmed by creating the complex with a PM6 donor molecule. The remarkable dipole moment contributes to the formation of non-covalent bond interactions with chloroform, resulting in superior charge mobility. Based on these findings, it can be said that every tailored molecule has the potential to surpass chromophore molecule (BTR) in OSCs. So, all tailored molecules may enhance the efficiency of photovoltaic cells due to the involvement of potent terminal electron-capturing acceptor2 moieties. Considering these obtained results, these newly presented molecules can be regarded for developing efficient solar devices in the future.

A novel series of alkaline earthides containing eight complexes based upon 3⁶adz complexant are designed by placing carefully transition metals (V–Zn) on inner side and alkaline earth metal outer side of the complexant i.e., M⁺(3⁶adz) Be⁻ (M⁺ = V, Cr, Mn, Fe, Co, Ni, Cu and Zn). All the designed compounds are electronically and thermodynamically stable as evaluated by their interaction energy and vertical ionization potential respectively. Moreover, the true nature of alkaline earthides is verified through NBOs and FMO study, showing negative charge and excess electrons on alkaline earth metal respectively. Furthermore, true alkaline earthides characteristics are evaluated graphically by spectra of partial density state (PDOS). The energy gap (HOMO -LUMO gap) is very small (ranging 2.95 eV–1.89 eV), when it is compared with pure cage 3⁶adz HOMO-LUMO gap i.e., 8.50 eV. All the complexes show a very small value of transition energy ranging from 1.68eV to 0.89eV. Also, these possess higher hyper polarizability values up to 2.8 x 10⁵au (for Co⁺(3⁶adz) Be⁻). Furthermore, an increase in hyper polarizability was observed by applying external electric field on complexes. The remarkable increase of 100fold in hyper polarizability of Zn⁺(3⁶adz) Be⁻ complex is determined after application of external electric field i.e., from 1.7 x 10⁴ au to 1.7 x 10⁶ au when complex is subjected to external electric field of 0.001 au strength. So, when external electric field is applied on complexes it enhances the charge transfer, polarizability and hyper polarizability of complexes and proves to be effective for designing of true alkaline earthides with remarkable NLO response.

At present, the hydrogen evolution reaction (HER) of Ni-based electrode has an important influence on water electrolysis hydrogen production technology, involving complex electrochemical process of electrode. In this project, Materials Studio (MS) software was used to design and construct Ni-based electrode surface (NES) models with monatomic Mo, Co, Fe, Cr doping, and the NES models attached 1 H atom and 2H atoms were denoted as the NES-H models and NES-2H model, respectively. Then the first-principles calculation was carried out.

The results showed that the doping of different atoms can effectively change the work function of the pure Ni. In the charge transfer process of the four NES-2H models, the distance between the two H atoms is most affected by Mo doping, and they leave the Ni electrode surface as a single H ion, respectively, while the effect on Co, Fe and Cr doping is relatively consistent, and they leave the Ni electrode surface with H₂ molecules, respectively. The doping of four single atoms changes the distance of valence band (VB) top and conduction band (CB) bottom from Fermi level in NES, NES-H and NES-2H models, and affects the HER, in which Mo doping has the greatest effect. The TDOS of the above models is mainly derived from the PDOS of the d orbitals of the doped atoms and Ni atoms. The results will provide a theoretical basis for the research and development of Ni-based electrode materials in HER.

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10⁻⁹ – 200 × 10⁻⁹ M), detection limit (1.0 × 10⁻⁹ M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase that modulates integrin and growth factor signaling pathways and is implicated in cancer cell migration, proliferation, and survival. Over the past decade various, FAK kinase, FERM, and FAT domain inhibitors have been reported and a few kinase domain inhibitors are under clinical consideration. However, few of them were identified as multikinase inhibitors. In kinase drug design selectivity is always a point of concern, to improve selectivity allosteric inhibitor development is the best choice. The current research utilized a pharmacophore modeling (PM) approach to identify novel allosteric inhibitors of FAK. The all-available allosteric inhibitor bound 3D structures with PDB ids 4EBV, 4EBW, and 4I4F were utilized for the pharmacophore modeling. The validated PM models were utilized to map a database of 770,550 compounds prepared from ZINC, EXIMED, SPECS, ASINEX, and InterBioScreen, aiming to identify potential allosteric inhibitors. The obtained compounds from screening step were forwarded to molecular docking (MD) for the prediction of binding orientation inside the allosteric site and the results were evaluated with the known FAK allosteric inhibitor (REF). Finally, 14 FAK-inhibitor complexes were selected from the docking study and were studied under molecular dynamics simulations (MDS) for 500 ns. The complexes were ranked according to binding free energy (BFE) and those demonstrated higher affinity for allosteric site of FAK than REF inhibitors were selected. The selected complexes were further analyzed for intermolecular interactions and finally, three potential allosteric inhibitor candidates for the inhibition of FAK protein were identified. We believe that identified scaffolds may help in drug development against FAK as an anticancer agent.