Molecular medicine reports最新文献

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I.  The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].

Alcohol‑related liver disease (ALD) is a major health concern worldwide. In recent years, there has been growing interest in natural products and functional foods for preventing and treating ALD due to their potential antioxidant and hepatoprotective properties. Rosa roxburghii Tratt, known for its rich content of bioactive compounds, has demonstrated promising health benefits, including anti‑inflammatory and antioxidant effects. Fermentation has been utilized as a strategy to enhance the bioavailability and efficacy of natural products. In the present study, using a mixture of Rosa roxburghii Tratt juice, lotus leaf extract and grape seed proanthocyanidins fermented by Lactobacillus plantarum HH‑LP56, a novel fermented Rosa roxburghii Tratt (FRRT) juice was discovered that can prevent and regulate ethanol‑induced liver cell damage. Following fermentation, the pH was significantly decreased, and the content of VC and superoxide dismutase (SOD) were significantly increased, along with a noticeable enhancement in hydroxyl and 2,2‑diphenyl‑1‑picrylhydrazyl free radical scavenging abilities. Alpha Mouse liver 12 cells were exposed to ethanol for 24 h to establish an in vitro liver cell injury model. The present study evaluated the effects of FRRT on cell damage, lipid accumulation and oxidative stress markers. The results revealed that FRRT pretreatment (cells were pre‑treated with 2.5 and 5 mg/ml FRRT for 2 h) significantly reduced lipid accumulation and oxidative stress in liver cells. Mechanistically, FRRT regulated lipid metabolism by influencing key genes and proteins, such as AMP‑activated protein kinase, sterol regulatory element binding transcription factor 1 and Stearyl‑CoA desaturase‑1. Furthermore, FRRT enhanced antioxidant activity by increasing SOD activity, glutathione and catalase levels, while reducing reactive oxygen species and malondialdehyde levels. It also reversed the expression changes of ethanol‑induced oxidative stress‑related genes and proteins. In conclusion, a novel functional food ingredient may have been discovered with extensive potential applications. These findings indicated that FRRT has antioxidant properties and potential therapeutic benefits in addressing ethanol‑induced liver cell damage through its effects on liver lipid metabolism and oxidative stress.

Following the publication of this paper, it was drawn to the Editor's attention by a concerned reader that certain of the immunohistochemical data shown in Fig. 1D and the flow cytometric data in Fig. 3K were strikingly similar to data appearing in different form in other papers by different authors at different research institutes that were under consideration for publication at around the same time.  Owing to the fact that the contentious data in the above article were already under consideration for publication prior to its submission to Molecular Medicine Reports, the Editor has decided that this paper should be retracted from the Journal. The authors were asked for an explanation to account for these concerns, but the Editorial Office did not receive a reply. The Editor apologizes to the readership for any inconvenience caused. [Molecular Medicine Reports 23: 263, 2021; DOI: 10.3892/mmr.2021.11902].

Glycolysis occurs in all living organisms as a form of energy supply. Pyruvate kinase M2 (PKM2) is one of the rate‑limiting enzymes in the glycolytic process. PKM2 is considered to serve an important role in several terminal diseases, including sepsis. However, to the best of our knowledge, the specific mechanistic role of PKM2 in sepsis remains to be systematically summarised. Therefore, the present review aims to summarise the roles of PKM2 in sepsis progression. In addition, potential treatment strategies for patients with sepsis are discussed. The present review hopes to lay the groundwork for studying the role of PKM2 and developing therapeutic strategies against metabolic disorders that occur during sepsis.

Chitinase‑3 like‑protein‑1 (CHI3L1), a glycoprotein belonging to the glycoside hydrolase family 18, binds to chitin; however, this protein lacks chitinase activity. Although CHI3L1 is not an enzyme capable of degrading chitin, it plays significant roles in abnormal glucose and lipid metabolism, indicating its involvement in metabolic disorders. In addition, CHI3L1 is considered a key player in inflammatory diseases, with clinical data suggesting its potential as a predictor of cardiovascular disease. CHI3L1 regulates the inflammatory response of various cell types, including macrophages, vascular smooth muscle cells and fibroblasts. In addition, CHI3L1 participates in vascular remodeling and fibrosis, contributing to the pathogenesis of cardiovascular disease. At present, research is focused on elucidating the role of CHI3L1 in cardiovascular disease. The present systematic review was conducted to comprehensively evaluate the effects of CHI3L1 on cardiovascular cells, and determine the potential implications in the occurrence and progression of cardiovascular disease. The present study may further the understanding of the involvement of CHI3L1 in cardiovascular pathology, demonstrating its potential as a therapeutic target or biomarker in the management of cardiovascular disease.

Tamoxifen is a widely used anti‑estrogen drug in the endocrine therapy of breast cancer (BC). It blocks estrogen signaling by competitively binding to estrogen receptor α (ERα), thereby inhibiting the growth of BC cells. However, with the long‑term application of tamoxifen, a subset of patients with BC have shown resistance to tamoxifen, which leads to low overall survival and progression‑free survival. The molecular mechanism of resistance is mainly due to downregulation of ERα expression and abnormal activation of the PI3K/AKT/mTOR signaling pathway. Moreover, the downregulation of targeted gene expression mediated by DNA methylation is an important regulatory mode to control protein expression. In the present review, methylation and tamoxifen are briefly introduced, followed by a focus on the effect of methylation on tamoxifen resistance and sensitivity. Finally, the clinical application of methylation for tamoxifen is described, including its use as a prognostic indicator. Finally, it is hypothesized that when methylation is used in combination with tamoxifen, it could recover the resistance of tamoxifen.

Systemic lupus erythematosus (SLE) is a multi‑system chronic autoimmune disease with a complex occurrence and development process, associated with immune disorders, uncertain prognosis, and treatment modalities which vary by patient and disease activity. At present, the clinical treatment of SLE mainly focuses on hormones and immunosuppressants. In recent years, the research on new treatment strategies for SLE has been booming, and strong preclinical results and clinical research have promoted the development of numerous drugs (such as rituximab and orencia), but numerous of these drugs have failed to achieve effectiveness in clinical trials, and there are some adverse reactions. Recent evidence suggests that resveratrol (RSV) has the effect of ameliorating immune disorders by inhibiting overactivation of immune cells. In the present review, advances in research on the protective effects and potential mechanisms of RSV against SLE are summarized and the potential potency of RSV and its use as a promising therapeutic option for the treatment of SLE are highlighted.

Following the publication of this paper, it was drawn to the Editor's attention by a concerned reader that the colony formation assay data shown in Fig. 5F on p. 7 were strikingly similar to data appearing in different form in several other articles written by different authors at different research institutes, which had already been published prior to the  submission of this article to the journal. In addition, possible anomalies were noted regarding the appearance of the western blots in the paper. Owing to the fact that the contentious data in the above article had already been published prior to its submission to Molecular Medicine Reports, the Editor has decided that this paper should be retracted from the Journal. The authors were asked for an explanation to account for these concerns, but the Editorial Office did not receive a reply. The Editor apologizes to the readership for any inconvenience caused. [Molecular Medicine Reports 24: 723, 2021; DOI: 10.3892/mmr.2021.12362].

Diospyros lotus has been traditionally used in Asia for medicinal purposes, exhibiting a broad spectrum of pharmacological effects including antioxidant, neuroprotective and anti‑inflammatory properties. While the anti‑itch effect of D. lotus leaves has been reported, studies on the detailed mechanism of action in microglia and astrocytes, which are members of the central nervous system, have yet to be revealed. The present study aimed to investigate effects of D. lotus leaf extract (DLE) and its main component myricitrin (MC) on itch‑related cytokines and signaling pathways in lipopolysaccharide (LPS)‑stimulated microglia. The effect of DLE and MC on activation of astrocyte stimulated by microglia was also examined. Cytokine production was evaluated through reverse transcription PCR and western blot analysis. Signaling pathway was analyzed by performing western blotting and immunofluorescence staining. The effect of microglia on astrocytes activation was evaluated via western blotting for receptors, signaling molecules and itch mediators and confirmed through gene silencing using short interfering RNA. DLE and MC suppressed the production of itch‑related cytokine IL‑6 and IL‑31 in LPS‑stimulated microglia. These inhibitory effects were mediated through the blockade of NF‑κB, MAPK and JAK/STAT pathways. In astrocytes, stimulation by microglia promoted the expression of itch‑related molecules such as oncostatin M receptor, interleukin 31 receptor a, inositol 1,4,5‑trisphosphate receptor 1, lipocalin‑2 (LCN2), STAT3 and glial fibrillary acidic protein. However, DLE and MC significantly inhibited these receptors. Additionally, astrocytes stimulated by microglia with IL‑6, IL‑31, or both genes silenced did not show activation of LCN2 or STAT3. The findings of the present study demonstrated that DLE and MC could suppress pruritic activity in astrocytes induced by microglia‑derived IL‑6 and IL‑31. This suggested the potential of DLE and MC as functional materials capable of alleviating pruritus.

Following the publication of this paper, it was drawn to the Editor's attention by a concerned reader that certain of the TUNEL assay data shown in Fig. 1C on p. 2853 and Fig. 5H on p. 2857 were strikingly similar to data that had already been published in different form in different articles written by different authors at different research institutes, or were submitted for publication at around the same time (a number of of which have now been retracted). Owing to the fact that the contentious data in the above article had already been published, or were already under consideration for publication, prior to its submission to Molecular Medicine Reports, the Editor has decided that this paper should be retracted from the Journal. The authors were asked for an explanation to account for these concerns, but the Editorial Office did not receive a reply. The Editor apologizes to the readership for any inconvenience caused. [Molecular Medicine Reports 19: 2849‑2860, 2019; DOI: 10.3892/mmr.2019.9946].