中国当代儿科杂志最新文献

Objectives: To investigate the clinical characteristics and prognosis of acute erythroleukemia (AEL) in children.

Methods: A retrospective analysis was conducted on the clinical data, treatment, and prognosis of 8 children with AEL treated at the First Affiliated Hospital of Zhengzhou University from January 2013 to December 2023.

Results: Among the 7 patients with complete bone marrow morphological analysis, 4 exhibited trilineage dysplasia, with a 100% incidence of erythroid dysplasia (7/7), a 71% incidence of myeloid dysplasia (5/7), and a 57% incidence of megakaryocytic dysplasia (4/7). Immunophenotyping revealed that myeloid antigens were primarily expressed as CD13, CD33, CD117, CD38, and CD123, with 4 cases expressing erythroid antigens CD71 and 2 cases expressing CD235a. Chromosomal analysis indicated that 2 cases presented with abnormal karyotypes, including +8 in one case and +4 accompanied by +6 in another; no complex karyotypes were observed. Genetic abnormalities were detected in 4 cases, with fusion genes including one case each of dup MLL positive and EVI1 positive, as well as mutations involving KRAS, NRAS, WT1, and UBTF. Seven patients received chemotherapy, with 6 achieving remission after one course of treatment; 2 underwent hematopoietic stem cell transplantation, and all had disease-free survival. Follow-up (median follow-up time of 6 months) showed that only 3 patients survived (2 cases after hematopoietic stem cell transplantation and 1 case during treatment).

Conclusions: Children with AEL have unique clinical and biological characteristics, exhibit poor treatment response, and have a poor prognosis; however, hematopoietic stem cell transplantation may improve overall survival rates.

Heart failure is a complex clinical syndrome and pediatric heart failure (PHF) has a high mortality rate. Early diagnosis is crucial for treatment and management of PHF. In clinical practice, various tests and examinations play a key role in the diagnosis of PHF, including continuously updated biomarkers, echocardiography, and cardiac magnetic resonance imaging. This article focuses on summarizing relevant research on biomarkers, examinations, combined testing, clinical models, and the grading and staging of PHF diagnosis, aiming to provide insights and directions for the diagnosis of PHF.

Objectives: To study the significance of serum 25-hydroxyvitamin D₃ [25-(OH)D₃] level in the clinicopathological characteristics and prognosis of children with immunoglobulin A vasculitis nephritis (IgAVN).

Methods: A retrospective analysis was conducted on the clinical data of children with IgAVN who underwent renal biopsy at Suzhou Hospital Affiliated to Anhui Medical University and Jinling Hospital of the Medical School of Nanjing University from June 2015 to June 2020. Based on serum 25-(OH)D₃ level, the patients were divided into a normal group and a lower group. The clinicopathological characteristics and follow-up data of the two groups were collected and compared.

Results: A total of 359 children with IgAVN were included. Compared to the normal group (62 cases), the lower group (297 cases) exhibited higher incidences of hematochezia and gross hematuria, higher levels of serum creatinine, blood urea nitrogen, urinary retinol protein, urinary N-acetyl-β-D-glucosaminidase, and quantitative urinary protein, and a longer duration from renal biopsy to urinary protein becoming negative, as well as lower estimated glomerular filtration rate and albumin level (P<0.05). Renal pathology in the lower group showed a higher occurrence of tubular interstitial injury, crescent formation, segmental sclerosis in glomeruli, and inflammatory cell infiltration in the renal interstitium compared to the normal group (P<0.05). Survival analysis indicated that the cumulative renal survival rate was lower in the lower group (P<0.05). Multivariate Cox regression analysis revealed that low serum 25-(OH)D₃ level is an independent risk factor for poor prognosis in children with IgAVN.

Conclusions: Children with IgAVN and low serum 25-(OH)D₃ level have relatively severe clinicopathological manifestations. Low serum 25-(OH)D₃ level is an independent risk factor for poor prognosis in children with IgAVN.

Objectives: To investigate the expression of soluble factor-related apoptosis ligand (sFasL) in peripheral blood and microRNA-147b (miR-147b) in monocytes in children with sepsis and their value in assessing prognosis.

Methods: A prospective study was conducted on 124 children with sepsis (sepsis group), 60 children with common infections (infection group), and 60 healthy children undergoing physical examinations (healthy control group). The independent risk factors for poor prognosis in children with sepsis were analyzed, and the value of serum sFasL and monocyte miR-147b in predicting poor prognosis in children with sepsis was assessed.

Results: The serum level of sFasL and the relative expression of miR-147b in monocytes were highest in the sepsis group, followed by the infection group and the healthy control group (P<0.05). The multivariate logistic regression analysis showed that the serum level of sFasL and the relative expression of miR-147b in monocytes were closely associated with the poor prognosis of children with sepsis (P<0.05). The receiver operating characteristic curve analysis showed that the combination of serum sFasL level and relative expression of miR-147b in monocytes had a larger area under the curve compared to each indicator alone in predicting the prognosis of children with sepsis (P<0.05).

Conclusions: There are significant increases in the level of sFasL in peripheral blood and the relative expression of miR-147b in monocytes in children with sepsis. The combined use of these two indicators has relatively high clinical value in assessing the prognosis of children with sepsis.

Objectives: To investigate the clinical sub-phenotype (SP) of pediatric acute kidney injury (AKI) and their association with clinical outcomes.

Methods: General status and initial values of laboratory markers within 24 hours after admission to the pediatric intensive care unit (PICU) were recorded for children with AKI in the derivation cohort (n=650) and the validation cohort (n=177). In the derivation cohort, a least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify death-related indicators, and a two-step cluster analysis was employed to obtain the clinical SP of AKI. A logistic regression analysis was used to develop a parsimonious classifier model with simplified metrics, and the area under the curve (AUC) was used to assess the value of this model. This model was then applied to the validation cohort and the combined derivation and validation cohort. The association between SPs and clinical outcomes was analyzed with all children with AKI as subjects.

Results: In the derivation cohort, two clinical SPs of AKI (SP1 and SP2) were identified by the two-step cluster analysis using the 20 variables screened by LASSO regression, namely SP_d1 group (n=536) and SP_d2 group (n=114). The simplified classifier model containing eight variables (P<0.05) had an AUC of 0.965 in identifying the two clinical SPs of AKI (P<0.001). The validation cohort was clustered into SP_v1 group (n=156) and SP_v2 group (n=21), and the combined derivation and validation cohort was clustered into SP1 group (n=694) and SP2 group (n=133). After adjustment for confounding factors, compared with the SP1 group, the SP2 group had significantly higher incidence rates of multiple organ dysfunction syndrome and death during the PICU stay (P<0.001), and SP2 was significantly associated with the risk of death within 28 days after admission to the PICU (P<0.001).

Conclusions: This study establishes a parsimonious classifier model and identifies two clinical SPs of AKI with different clinical features and outcomes.The SP2 group has more severe disease and worse clinical prognosis.

Objectives: To investigate the epidemiological characteristics and changing trends of communicable diseases among children and adolescents in China from 1990 to 2021.

Methods: Based on the Global Burden of Disease Database, epidemiological indicators for communicable diseases among the population aged under 20 years in China from 1990 to 2021 were selected to analyze the burden of communicable diseases in this population, and a comparative analysis was performed with global data as well as data from Western Europe and North America.

Results: In 1990-2021, the overall burden of communicable diseases tended to decrease among children and adolescents in China. In 2021, the prevalence rate of communicable diseases in China was lower than the global prevalence rate and was higher than that in Western Europe and North America. There was a significant reduction in the mortality rate of communicable diseases, and the gap with Western Europe and North America gradually narrowed year by year. The overall incidence rate, mortality rate, and disability-adjusted life year rate of communicable diseases in males were higher than those in females, and respiratory infections and intestinal infections were more common in children aged <5 years, while the incidence rate of sexually transmitted diseases was higher in adolescents.

Conclusions: From 1990 to 2021, the disease burden of communicable diseases among the population under 20 years old in China has significantly decreased. However, there is still a certain gap compared to developed regions. Strengthening the prevention and control of diseases such as respiratory infections and acquired immunodeficiency syndrome, as well as enhancing health interventions for children under 5 years old, will help improve the overall health level of children and adolescents in China.

Patients with Noonan syndrome (NS) are born with normal or slightly lower body length and weight compared to the normal ranges. However, their height gradually falls behind that of the general population, leading to growth retardation and delayed puberty. In China, the incidence of short stature in patients with NS is approximately 65%. Short stature in these patients arises from multiple causes, including feeding difficulties in infancy, comorbidities such as congenital heart disease, genetic heterogeneity, and disorders of the growth hormone/insulin-like growth factor-1 axis. Growth hormone is commonly used to alleviate symptoms of short stature. This article reviews the growth and development patterns at different stages of NS, analyzes the causes of short stature, and summarizes the latest advances in treatment to provide new insights for the diagnosis and management of short stature in patients with NS.

Adolescence is a critical period for the development of the reward circuit, and reward positivity (RewP) is one of the electrophysiological indicators reflecting reward processing. Many studies have shown that abnormalities in RewP is closely associated with internalizing and externalizing problems in children and adolescents. In addition, factors such as stressful life events and sleep disorders can affect reward-related brain activity and increase the risk of various psychopathological problems in this population. The article reviews the characteristics of changes in RewP among children and adolescents with various internalizing and externalizing problems in recent years, aiming to provide a reference for the basic research on the pathogenesis of these issues and to identify new targets for clinical diagnosis and treatment.

Children with bronchopulmonary dysplasia (BPD) often exhibit severe respiratory problems and significant pulmonary dysfunction during school age and adulthood. Exercise tests show a decline in cardiopulmonary function and physical performance in children with BPD, who also have a higher incidence of pulmonary hypertension. These children generally perform poorly in terms of intelligence, language, and motor development. As they age, the risk of neurodevelopmental disorders increases, and health-related quality of life is also affected. This article reviews the prognosis of the respiratory system, physical capacity, cardiovascular system, nervous system, and health-related quality of life in children with BPD, aiming to improve the management of these patients and enhance their subsequent quality of life.

Objectives: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.

Methods: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.

Results: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.

Conclusions: This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.