Neural crest cells are a transient cell population that emerges from the dorsal neural tube during neurulation and migrates extensively throughout the embryo. Among their diverse derivatives, glial cells (such as Schwann and satellite ganglionic cells) and melanocytes represent two major lineages. In vitro studies suggested they share a common progenitor yet follow distinct differentiation pathways. Hence, neural crest cells must choose between glia and melanocyte fates-a decision crucial for forming the peripheral nervous and pigmentary systems. A groundbreaking discovery revealed that Schwann cell precursors along peripheral nerves serve as a secondary source of melanocytes during development. This finding challenged the traditional view that melanocytes arise exclusively from direct neural crest migration and demonstrated remarkable plasticity in the glial lineage. This glia/melanocyte fate choice represents a well-characterized example of binary fate decisions in vertebrate development, involving complex interactions between transcriptional networks, signaling pathways, and environmental cues. Importantly, the glia/melanocyte decision has implications for cancer and injury-induced plasticity, where embryonic pathways may be reactivated. For example, during melanomagenesis, cells can exhibit both melanocytic and glial features. Understanding how neural crest cells decide between glial and melanocyte fates may offer new insights for regenerative medicine and cancer therapy.
In vertebrate embryogenesis, cranial neural crest cells (CNCCs) migrate along discrete pathways. Analyses in the chick have identified key molecular candidates for the confinement of CNCC migration to stereotypical pathways as Colec12, Trail, and Dan. The effects of these factors on CNCCs in vitro are known, but how they confine migration to discrete streams in vivo remains poorly understood. Here, we propose and test several hypothetical mechanisms by which these factors confine cell streams and maintain coherent migration, simulating an expanded agent-based model for collective CNCC migration.
Model simulations suggest that Trail enhances adhesion between CNCCs, facilitating movement towards stereotypical migratory pathways, whereas Colec12 confines CNCCs by inducing longer, branched filopodia that facilitate movement down Colec12 gradients and re-connections with streams. Moreover, we find that Trail and Colec12 facilitate the exchange of CNCCs and the formation of CNCC bridges between adjacent streams that are observed in vivo but poorly understood mechanistically. Finally, we predict that Dan increases the coherence of streams by modulating the speed of CNCCs at the leading edge of collectives to prevent escape.
Our work highlights the importance of Trail, Colec12, and Dan in CNCC migration and predicts novel mechanisms for the confinement of CNCCs to stereotypical pathways in vivo.
Background: Knockin mouse models expressing calbindin (Calb1), calretinin (Calb2), and peripherin (Prph) exhibit changes in hair cells (HCs), spiral ganglion neurons (SGN), vestibular ganglion neurons (VGNs), and their central projections.
Results: Developing cristae HCs show strong Calb1-positive expression, but adult HCs are mainly Calb2-positive. Utricle and saccule initially have Calb2-positive HCs and later develop Calb1-positive HCs in the striola region. Inner hair cells (IHCs) and outer hair cells (OHCs) in the cochlea express Calb2 early on. Calb1 expression in OHCs overlaps with Calb2; the expression of Myo7a, Calb1, and Calb2 reaches the apex later. SGNs and VGNs exhibit distinct Calb1 and Calb2 patterns but include a subpopulation with mixed expression. Central fibers are Calb1- and Calb2-positive early in the developing cochlear nuclei (CN) and vestibular nuclei (VN) but remain highly Prph-positive. VGNs innervate the lateral and VN, which are positive for Calb2 and Prph. Distinct Calb1-positive neurons overlap with the anterior (A) and ventral (V) cochlear nuclei (AVCN, PVCN) with Calb2, while the dorsal cochlear nucleus (DCN) shows segregation of Calb2 and Calb1.
Conclusion: We offer insights into the timing of how neuronal identity and connectivity are regulated in the auditory and vestibular systems, as shown by the expression of Calb1, Calb2, and Prph.
In an era where the diversity and quality of imaging modalities is rapidly increasing, it may seem counterintuitive to promote classical histology as a critical skill. It is a mistake, however, to assume that the heuristic potential of these high-resolution histological data is stagnant. Deep learning algorithms have emerged as an efficient tool for converting and quantifying the cellular resolution of 2D histology sections as detailed 3D models, capable of being integrated with a diversity of multi-omics data. Such analytical innovation requires large numbers of high-quality slides whose construction faces a variety of technical challenges. These challenges are exaggerated for developmental and evolutionary biologists, for whom ontogeny and phylogeny are critical variables that require additional sampling. Our goal is to provide a protocol optimized for the thin-section histology of vertebrate embryos, detailing best practices for sample collection, processing, and slide preparation. We hope that by: (1) synthesizing a scattered methodological literature that often excludes embryological tissues, and (2) recommending adjustments to common techniques like dehydration, xylene infiltration, and sectioning, other researchers may bypass the frustrating and time-consuming problems we encountered and move quickly to producing the high-quality histological data that modern developmental biology is likely to demand.
Keil S, Gupta M, Brand M, Knopf F. Heparan sulfate proteoglycan expression in the regenerating zebrafish fin. Dev Dyn 2021;1–13. https://doi.org/10.1002/dvdy.321
In the originally published article, in Figure 1A of the “Results” section, the authors displayed glypican 6b (gpc6b) expression on the basis of reverse transcription polymerase chain reaction (RT-PCR), performed with the primers CACCAAAGGCTTCAGTCTCC and CCATAAGTCCCTGGACGAAG (primers listed for gpc6b in Table 1 in the original version of the article). These primers actually amplify glypican 6a (gpc6a), not gpc6b. The correct primers for gpc6b are CAGTTCTGATGATGTGCCCG and CGCAAGTCCCTGTACGAATG (updated in Table 1, see below); the correct RT-PCR outcome is updated in Figure 1A (see below).
gpc6b expression is present at 3-day post-amputation (dpa) as stated already in the text. However, expression in uninjured fin tissue was not detected by RT-PCR with the correct primers. The authors therefore correct the sentence “Expression in uninjured fins was similar but weaker (Figure 1A)”, in Section 2.1 “Detection of HSPG via reverse transcription polymerase chain reaction” to the following: “Expression in uninjured fins was similar but weaker or sometimes absent (Figure 1A)”.
The PCR reaction was run with Phusion High-Fidelity DNA-Polymerase (Thermo Scientific) with an annealing temperature of 59°C and for 35 cycles as stated in the experimental procedures (Section 4.2 “RT-PCR”).
We apologize for this error and thank Holly L. Paddock (ZFIN, USA) and Nicole Cudak (TU Dresden, Germany) for help in correcting this error.
Background: Integrin is an αβ heterodimeric receptor to the extracellular matrix; its binding to the matrix recruits focal adhesions to two NPxY motifs, the tyrosine phosphorylation sites in the cytoplasmic domain. Studies found that replacing tyrosines (Y) with phenylalanines (F) in the motif of β1 integrin displayed little developmental or behavioral defects. However, the tyrosine-to-alanine (A) caused embryonic lethality.
Results: Here we report novel functions of the NPxY motifs in Caenorhabditis elegans pat-3 β integrin. The membrane-proximal non-phosphorylation pat-3(Y792F) mutation caused hypersensitive egg laying in serotonin, which is more prominent than the membrane-distal NPxY804. The double non-phosphorylatable pat-3(YYFF) mutant exhibited serotonin hypersensitivity and defective egg retention. The phosphomimetic NPxY, pat-3(Y804E), mutant displayed reduced egg laying in response to serotonin and fluoxetine, suggesting that the NPxY phosphorylation is associated with vulval contraction and serotonin sensitivity. Additionally, pat-3(Y792A), pat-3(Y792F), pat-3(Y804E), and pat-3(YYFF) mutants exhibited mechanosensation defects, demonstrating that NPxY phosphorylation regulates sensory neuron activity. Further analysis revealed that exogenous serotonin reduced mechanosensation, while blocking serotonin secretion rescued the mechanosensation of pat-3 NPxY mutants, suggesting that integrin NPxY modulates serotonin levels in C. elegans.
Conclusion: Our results underscore the functional importance of pat-3 NPxY motifs in muscle and neurons, potentially linking integrin NPxY motifs to neurotransmitter response and mechanosensory functions.
Background: Tadpoles of the clawed frog Xenopus laevis can regenerate their tails following partial amputation, replacing the missing spinal cord, muscles, and fin. However, for a brief period of development this response becomes unstable, leading to a proportion of tadpoles that undergo wound healing rather than regenerative programme. Inspired by a growing number of links between the microbiome and human inflammatory disease, we asked how the tadpole skin microbiome and innate immunity influence the regeneration of a complex appendage. We previously showed that tadpoles raised in antibiotics such as gentamicin or penicillin/streptomycin or with reduced Toll-like receptor 4 signaling regenerated tails poorly, while adding exogenous lipopolysaccharide promoted or rescued tail regeneration.
Results: Here, we show that CRISPR/Cas9 knockdown of Toll-like receptor 2 also reduces tadpole tail regeneration. Conversely, addition of the pathogen-associated molecular pattern peptidoglycan to the medium at the time of amputation increases the likelihood of regeneration. While we have previously shown that tadpoles acquire most of their early skin microbiome from their mothers, analysis of mitochondrial haplotypes did not support a genetic maternal explanation of regenerative bias. Levels of endogenous lipopolysaccharides on tail tips were also not predictive of regenerative success, and shotgun sequencing indicated that there was no difference in bacterial loads. To see if the composition of native microbiome was associated with regenerative success, we sequenced the 16S rRNA genes of 503 tadpole tail tips from 12 sibships and mapped these to the regenerative outcome of each tadpole. While no one taxon was found to be associated with regenerative success, higher proportions of Gram-positive genera overall correlated with improved regeneration outcomes. Supporting this finding, when tadpoles were raised with the antibiotic vancomycin, to select against Gram-positive bacteria, the number of individuals undergoing tail regeneration was significantly decreased.
Conclusions: Taken together, our results suggest a previously undocumented role for Tlr2, possibly activated by peptidoglycan from Gram-positive commensal skin bacteria, in tipping the balance from wound repair to regenerative programmes in Xenopus laevis refractory stage tadpoles.
Background: Building and disassembling actin filaments is essential for the remodeling of the actin cytoskeleton. In large structures, like Drosophila bristles, the loss of function of actin disassembly proteins can lead to smaller and misshapen bundled actin. Here we investigate whether mutant alleles of the disassembly genes twinstar (tsr), flare (flr), and twinfilin (twf) show similar phenotypes in smaller embryonic actin-based denticles. We also examined potential genetic interactions between F-actin disassembly proteins and the molecular motor ck/myosin VIIA, a protein necessary for denticle formation.
Results: Cuticle preparations of late-stage embryos were examined for denticle hook orientation, height, and width. There were mild morphological phenotypes such as loss of hook polarity across the genes. Single mutants for the disassembly genes showed that loss of tsr caused denticles to be longer, loss of twf resulted in shorter denticles, and mutant flr alleles showed varied effects. Double mutants of tsr and twf showed a genetic interaction in widths of denticles while ck was epistatic to twf and flr for width.
Conclusion: These results demonstrate that actin disassembly proteins and ck/myosin VIIA are involved in denticle formation, and the lack of wild type gene function in tsr, twf, flr, and ck causes measurable defects in denticle morphology.
Background: Sporadic venous malformation (VM) is associated with the hyperactivating p.L914F mutation in TIE2, a receptor tyrosine kinase essential for vascular development. This mutation is not found in hereditary VM, suggesting incompatibility with life when expressed during early vascular development. Therefore, we utilized a genetic mouse model that expresses TIE2 p.L914F to determine its phenotypical effects during development.
Results: B6-Tg(Rosa26-TIE2L914F)EBos (TIE2L914F) mice were generated and then validated for the presence of the transgene. The constitutive endothelial-specific Tie2-Cre line was used to activate expression of the mutant gene during early embryonic development. Tie2-Cre;TIE2L914F embryos experienced lethality at approximately embryonic day (E)9.5. Three-dimensional imaging of embryos and yolk sacs revealed impaired vascular remodeling in mutant animals, resulting in malformed vasculature with disorganized, dilated, and non-functional blood vessels. The abnormal yolk sac vascular phenotype was not associated with total loss of erythroid cells or increased cell proliferation.
Conclusions: The TIE2L914F mice used in this study represent a novel genetic model of TIE2 p.L914F-driven vascular disease. This study provides the first experimental evidence that this mutation is incompatible with early prenatal development due to its deleterious effects on the vasculature, illustrating the vital role of balanced TIE2 signaling during vessel development and remodeling.
京公网安备 11010802042870号
京ICP备2023020795号-1
扫码关注我们
求助内容：
应助结果提醒方式：