Hematology最新文献

The impact of epigenetic modifier gene mutations (EMMs) on the prognosis of patients with acute lymphoblastic leukemia (ALL) is controversial, which is unlike AML. A meta-analysis is needed to evaluate the prognostic value of EMMs in ALL.

Three databases, including PubMed, EMBase and Web of Science, were retrieved to find out studies exploring the association of EMMs and survival outcomes in ALL. Pooled hazard ratios (HRs) and 95% confidential interval (95%CI) were used to assess the impact of EMMs.

Nineteen studies were included in our meta-analysis. DNMT3A mutation was an adverse prognostic factor in overall survival (OS) in patients with ALL (HR, 4.143; P < 0.001) as well as adult T-ALL patients (HR, 3.746; P < 0.001) and those with early T-ALL (HR, 3.523; P = 0.001). IDH mutation also had an unfavorable impact on OS in ALL (HR, 3.583; P < 0.001) and adult T-ALL cohort (HR, 3.562; P < 0.001). For pediatric patients, mutant PHF6 was significantly associated with worse OS in both B-ALL (HR, 3.194; P = 0.026) and T-ALL (HR, 2.125; P = 0.033), while PHF6 mutation had no prognostic impact on the survival of adult T-ALL patients. In addition, patients with KMT2A mutation had shorter OS compared to those with wild type (HR, 4.605; P = 0.045), whereas other EMMs had no impact on prognosis in any type of ALL.

Mutations in DNMT3A, IDH, PHF6 and KMT2A showed a significant prognostic effect in ALL or in its specific subtypes, which might contribute to risk stratification and treatment guidance in the management of ALL patients.

Background: Hypoplastic myelodysplastic syndrome (hMDS) is an uncommon MDS subtype, accounting for approximately 10-15% of cases, characterized by bone marrow hypocellularity, severe cytopenias, and features of immune dysregulation. Its clinical course overlaps with aplastic anemia, yet optimal management for lower-risk patients remains undefined, particularly in Asian populations.

Methods: We retrospectively analyzed 48 patients with lower-risk hMDS (IPSS-R very low/low/intermediate) treated at Tianjin Medical University General Hospital from 2013 to 2021. Patients received cyclosporine A (CsA, n = 16), hypomethylating agents (HMAs, n = 10), low-dose HMAs (LD-HMAs, n = 11), or best supportive care (BSC, n = 11). Responses were assessed by modified IWG criteria, and survival was evaluated by Kaplan-Meier and Cox regression analyses.

Results: Median age was 61 years (range 16-84), with 60.4% male. Somatic mutations were present in 64.6%, and PNH clones in 29.2%. Six-month overall response rates were 75.0% for CsA, 70.0% for HMAs, 54.5% for LD-HMAs, and 36.4% for BSC (p = 0.220). CsA achieved significantly longer complete remission (median 75 months) and hematologic improvement durations (p < 0.05). Median overall survival (OS)/progression-free survival (PFS) for CsA were 78.0/76.0 months, compared with 17.0/6.8 for HMAs, 31.0/15.0 for LD-HMAs, and 36.0/15.0 for BSC (p < 0.01). HMAs were associated with increased grade 3-4 infections.

Conclusion: CsA provides superior response durability, survival outcomes, and safety compared with other approaches, supporting its use as first-line therapy in lower-risk hMDS. Integration of immune and molecular profiling may refine individualized treatment strategies.

Objective: This review aims to summarize current progress in targeted therapy for acute myeloid leukemia (AML) with KMT2A rearrangement (KMT2Ar). This subtype of AML often shows resistance to chemotherapy and has a poor prognosis. The purpose is to emphasize potential therapeutic strategies and explore drugs currently under clinical development. Methods: We reviewed studies on the molecular characteristics of KMT2Ar AML and examined targeted drugs that can block key genetic and epigenetic mechanisms. Information on drug mechanisms, preclinical findings, and clinical trials was collected and analyzed.

Results: Several new agents targeting KMT2A-related pathways are being explored. Menin inhibitors show encouraging clinical activity, while other inhibitors, such as those targeting DOT1L, BET, and EZH2, have produced promising preclinical results. Early data suggest that combination therapy may be more effective in overcoming drug resistance than monotherapy.

Discussion: Providing a new therapeutic direction for the abnormal molecular networks in KMT2Ar AML offers a promising approach. However, most therapies are still in the early stages and clinical translation is limited. Further research is needed to improve the safety and long-term efficacy of the treatment.

Conclusion: There is an urgent need for effective targeted drugs for KMT2Ar AML. Continuous research and clinical trials will be key to improving patient prognosis and advancing precise treatment for this challenging leukemia subtype.

Objectives: To investigate the clinical significance of Fluorescence in situ hybridization (FISH) in detecting aberration of chromosome 5, 7, or 17 in newly diagnosed acute myeloid leukemia (AML) patients.

Methods: We retrospectively evaluated the clinical features and outcomes of 77 adult newly diagnosed AML patients with 5/5q, 7/7q, or 17/17p loss detected by either FISH or conventional karyotype.

Results: Among 77 patients, all (100%) were identified by FISH, while only 47 (61%) were positive with conventional karyotype. Patients with FISH-positive displayed similar age at onset, gender, WBC, and gene mutation spectrum with those identified by karyotype. In FISH-positive but karyotype-negative group, the 3-year OS and EFS were 28.9% and 23.9%, respectively, which were similar to 29.1% and 21% with FISH-positive and karyotype-positive (P = 0.59 and 0.48). When comparing the outcomes of patients with or without hematopoietic stem cell transplantation (HSCT), both groups of patients with and without HSCT showed similar outcomes. Patients underwent HSCT with 3-year OS at 76.2% in FISH and 64.3% in FISH-positive and karyotype-positive group (P = 0.66), while patients without HSCT had 3-year OS at 33.3% and 39% (P = 0.63), respectively.

Conclusion: Overall, patients with 5, 7, or 17 chromosomal abnormalities identified by either FISH or karyotype have similar clinical characteristics and outcomes. FISH could supplement to conventional karyotype for detecting aberration of chromosome 5, 7, or 17 in newly diagnosed AML.

Background: Platelet concentrates play an important role in clinical treatment such as platelet function disorders and thrombocytopenia. In the process of preparation and storage of platelets, centrifugation, leukofiltration, and agitation will cause morphological changes and impaired function of platelets, which is associated with the increase of platelet transfusion refractoriness, and named as platelet storage lesion (PSL).

Method: This paper proposes three major operations (centrifugation, agitation, and leukofiltration) that platelets experience during the preparation and storage process, to explore the effect of physical cues on PSL. The analysis of morphology, metabolism index, and levels of activation markers are used to monitor the quality of stored platelets and definite the role of physical cues in PSL.

Result: In this study, centrifugation, leukofiltration and agitation lead to different degrees of platelet activation, with the extension of storage time. At one hour after separation, PSL can be found through structural change, metabolic parameters, and activation markers of platelets. Agitation maintains more cell numbers, better cell morphology, and lower metabolism rate in platelets, and keeps the low activation state of platelets throughout the storage period. The hard centrifugation group showed the highest level of CD62P expression throughout the storage.

Conclusion: our results indicate that agitation can mitigate PSL by supplying sufficient O₂ during preservation, shear stress may cause PSL immediately after the physical cues were applied; however, hydrostatic pressure induced by filtration is negligible for its effects on PSL. Meanwhile, when the physical cues are big enough, the activation of platelets is irreversible, such as spin at 2000 g. The granule secretion of platelets is a kind of irreversible activation; however, the membrane reorganization of platelets is a kind of reversible activation.

Background: Iron deficiency anemia (IDA) is the most common cause of anemia worldwide. Patients with IDA often present thrombocytosis, but little is known about its degree and prevalence, and its response to iron replacement.

Methods: We conducted a retrospective review of 76 consecutive patients with anemia secondary only to iron deficiency. Laboratory data were collected both at baseline and at 3 months after either oral or intravenous iron replacement therapy. We defined thrombocytosis as a platelet count >400 × 10⁹/L.

Results: The median age of the patients was 54 years (range, 22-90 years), and 59 of 76 (78%) patients were females. The replacement therapy consisted of oral iron (n = 13), intravenous iron (n = 33), or both (n = 30). The median Hb and ferritin levels at baseline and at 3 months after the iron replacement were 9.9 g/dL and 18 mg/dL, and 12.4 g/dL (p < 0.0001) and 113 mg/dL (p < 0.0001), respectively. Thrombocytosis before and after the iron administration was present in 17 (22%) and 4 (5%) patients, respectively. Regardless of thrombocytosis, the platelet count decreased in 55 (72%) patients. The median platelet level at baseline and at 3 months after the iron replacement was 299 (95% CI, 276-330) and 265 (95% CI, 245-295) × 10⁹/L (p < 0.0001), respectively.

Conclusion: Thrombocytosis is found in about one fifth of patients with IDA at baseline, and it is expected to resolve within 3 months of iron replacement therapy in most of them. Iron administration is associated with a decrease of the platelet counts, even in the absence of preexisting thrombocytosis.

Background: While there has been no direct head-to-head comparison, it is assumed that second-line treatment with dasatinib and nilotinib has comparable efficacy but distinct safety profiles in the treatment of patients with chronic phase chronic myeloid leukemia (CML-CP). Our aim was to conduct a real-world analysis to compare the efficacy and safety profiles of these two agents.

Methods: Data from 73 CML-CP patients, who received either dasatinib or nilotinib in second-line treatment, were analyzed. The primary interest of the efficacy assessment was a major molecular response (MMR) at the 12-month, 5-year cumulative incidence of treatment failure, and overall survival.

Results: A total of 73.5% of 34 patients in the dasatinib and 76.9% of 39 patients in the nilotinib group achieved MMR at 12 months. Five-year cumulative probability of treatment failure in patients, who previously achieved MMR was 0 and 7.6% for patients receiving dasatinib and nilotinib, respectively (p = 0.25). Eight-year OS was 82.7 and 86.3% for dasatinib and nilotinib groups, respectively (p = 0.90). Pleural effusions were more common in the dasatinib group, leading to treatment discontinuation, while cardiovascular events and thrombotic incidents were more prevalent in the nilotinib group.

Conclusion: Dasatinib and nilotinib exhibit similar efficacy in the CML-CP treatment. Individualized patient management should consider patient comorbidities and safety profiles.

Background: The health implications of trace elements have become increasingly concerning, yet the connection between blood manganese levels and anemia remains insufficiently examined. This research endeavors to explore the potential linkage between blood manganese concentrations and anemia.

Methods: Utilizing data from the National Health and Nutrition Examination Survey (NHANES) from 2011 to 2018, this study examines the correlation between blood manganese levels and anemia among U.S. adults, offering a comprehensive national perspective. The study included 11,300 adults aged 20 and above, with both blood manganese and hemoglobin levels measured. Generalized Additive Model (GAM) was applied to delineate smooth curves, and threshold effect analysis was performed to identify the inflection points of these curves. Subsequently, unconditional logistic regression was employed to assess the risk.

Results: Our research involved a total of 11,300 individuals, among which 1,143 (10.1%) were identified with anemia. The curve fitting analysis indicated a U-shaped relationship between blood manganese levels and the risk of anemia. Specifically, when blood manganese levels were below 8.69 µg/L, increasing concentrations were linked to a decreased risk of anemia, with an adjusted OR of 0.838 (95% CI: 0.735-0.954), indicating a protective effect of this level of blood manganese against anemia. Conversely, when blood manganese levels were at or above 8.69 µg/L, further elevations were strongly associated with an increased risk of anemia, with the adjusted OR rising to 1.160 (95% CI: 1.124-1.196), suggesting that excessively high blood manganese levels significantly raised the risk of developing anemia.

Conclusion: This study provides novel insights into the association between blood manganese levels and anemia. Further extensive, population-based cohort studies are necessary to validate the causality and to uncover the intrinsic toxicological mechanisms.

Background: This study investigates the expression and clinical significance of the histamine receptor family (HRs) in the bone marrow of children with newly diagnosed acute myeloid leukemia (AML).

Methods: RNA sequencing was performed to assess the expression levels of HR family members (HRH1, HRH2, HRH3, and HRH4) in the bone marrow of 140 pediatric AML patients prior to chemotherapy. We compared the expression levels across various risk categories and assessed their relationship with prognosis using ROC curve analysis to evaluate predictive capabilities for outcomes.

Results: Among the 140 AML patients in our center, those with different FAB subtypes showed varying overall survival (OS), event-free survival (EFS), and relapse-free survival (RFS). Specifically, the M2 and M4 subtypes showed better OS, EFS, and RFS, whereas the M5 subtype had poorer outcomes. Among patients with different fusion genes, those with AML1/ETO had superior OS, EFS, and RFS compared to other subtypes. Additionally, patients with CEBPA mutations demonstrated relatively favorable outcomes, whereas those with FLT3 mutations had poorer survival metrics. HRH1 expression was significantly higher in AML patients than in normal controls (P < 0.05). Patients in the high HRH1 expression group had significantly better EFS and RFS than those in the low expression group (P < 0.05). Furthermore, HRH1 expression was significantly higher in the low-risk (LR) group than in the intermediate and high-risk (IR & HR) groups (P < 0.05). This finding suggests that HRH1 may serve as an early predictor of risk, EFS, and RFS.

Conclusion: The clinical significance of HR family members varies in pediatric AML, with HRH1 identified as a valuable predictor of relapse in children with AML.

Objective: Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

Methods: The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

Results: The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

Conclusions: We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.