Hematology最新文献

Allogeneic hematopoietic stem cell transplantation (Allo-HSCT) remains the mainstay of treatment for adults with high-risk acute lymphoblastic leukemia (ALL). Due to the crucial role of measurable residual disease (MRD) before Allo-HSCT in predicting relapse and the promising anti-leukemia effect of blinatumomab, we documented a short-course, low-dose conditioning regimen incorporating blinatumomab for Allo-HSCT in three ALL patients with positive MRD. Following the administration of the blinatumomab-containing conditioning regimen, all patients attained complete remission (CR) with negative MRD status, and no severe adverse events were observed. After a 2-year follow-up, 2/3 of patients remained disease-free and attained long-term survival following transplantation. These cases indicated a short-term blinatumomab conditioning regimen may effectively prolong patient survival, improve prognosis, and offer a safe and cost-effective treatment for high-risk ALL patients with positive MRD. The addition of blinatumomab to the conditioning regimen of Allo-HSCT is feasible for high-risk ALL patients with positive MRD.

Objective: Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

Methods: The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

Results: The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

Conclusions: We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

Objectives: Controlling Nutritional Status (CONUT) Score is an effective tool for the assessment of malnutrition and proved to be associated with survival of Diffuse large B-cell lymphoma (DLBCL) patients. We investigated the impact of CONUT score on specific subgroups of DLBCL patients, including age and International prognostic Index (IPI) risk groups.

Methods: Data of 287 newly diagnosed DLBCL in the Third Affiliated Hospital of Soochow University were retrospectively collected. Baseline CONUT score, clinical data and survival information were recorded.

Results: With the standard cut-off value of 4 points, 88 (30.7%) patients were clarified as malnourished. During a median follow-up of 34 months, malnourished patients exhibited significant reduction in both progression-free survival (PFS) and overall survival (OS). The 3-year PFS rates for malnourished and well-nourished patients were 51.4% and 70.9% (p = 0.001), while the 3-year OS rates were 62.4% and 84.0% (p < 0.001). Malnutrition was demonstrated an independent predictor of OS in DLBCL patients (HR 2.220, 95% CI 1.307-3.772, p = 0.003). It could effectively identify patients with inferior OS in both low/intermediate-low risk and intermediate-high/high risk IPI groups. In the group of elderly patients aged over 60 years, malnutrition was independently associated with OS (HR 2.182, 95% CI 1.178-4.040, p = 0.024), but not PFS (HR 1.709, 95% CI 1.016-2.875, p = 0.070) after adjustment using the Benjamini-Hochberg procedure. Conversely, for younger patients, malnutrition did not demonstrate an independent impact on either PFS or OS.

Conclusion: Malnutrition evaluated by CONUT score was an independent predictor for the outcome of DLBCL patients, which is exclusively caused by its effect on elderly patients.

Background: Platelet concentrates play an important role in clinical treatment such as platelet function disorders and thrombocytopenia. In the process of preparation and storage of platelets, centrifugation, leukofiltration, and agitation will cause morphological changes and impaired function of platelets, which is associated with the increase of platelet transfusion refractoriness, and named as platelet storage lesion (PSL).

Method: This paper proposes three major operations (centrifugation, agitation, and leukofiltration) that platelets experience during the preparation and storage process, to explore the effect of physical cues on PSL. The analysis of morphology, metabolism index, and levels of activation markers are used to monitor the quality of stored platelets and definite the role of physical cues in PSL.

Result: In this study, centrifugation, leukofiltration and agitation lead to different degrees of platelet activation, with the extension of storage time. At one hour after separation, PSL can be found through structural change, metabolic parameters, and activation markers of platelets. Agitation maintains more cell numbers, better cell morphology, and lower metabolism rate in platelets, and keeps the low activation state of platelets throughout the storage period. The hard centrifugation group showed the highest level of CD62P expression throughout the storage.

Conclusion: our results indicate that agitation can mitigate PSL by supplying sufficient O₂ during preservation, shear stress may cause PSL immediately after the physical cues were applied; however, hydrostatic pressure induced by filtration is negligible for its effects on PSL. Meanwhile, when the physical cues are big enough, the activation of platelets is irreversible, such as spin at 2000 g. The granule secretion of platelets is a kind of irreversible activation; however, the membrane reorganization of platelets is a kind of reversible activation.

In this retrospective case-control study involving 424 pediatric patients diagnosed with Pediatric Acute Lymphoblastic Leukemia (ALL), the investigation focused on analyzing the clinical characteristics and prognosis associated with the Cyclin-dependent kinase inhibitor 2A/2B (CDKN2A/2B) gene. Treatment and evaluation followed the South China Children's Leukemia Group-ALL-2016 protocol (SCCLG-ALL-2016). Among the cohort, 92 patients (21.7%) exhibited CDKN2A/2B gene deletions, with 11.1% homozygous and 10.6% heterozygous deletions. Notably, ALL patients that do have CDKN2A/2B gene deletions tended to present at an older age (P = 0.001), demonstrate hepatosplenomegaly on palpation (P < 0.001), and exhibit a higher incidence of Central nervous system leukemia (CNSL) (P = 0.037) and T-ALL (P = 0.007). A significant correlation was observed between ALL that does have CDKN2A/2B gene deletions and ETV6::RUNX1-positive (8.7% vs. 19.3%, P = 0.017) and IKZF1 gene deletions (20.7% vs. 8.4%, P = 0.001). Survival analysis of 392 patients revealed no significant differences in 5-year relapse, Overall survival (OS), or Event-free survival (EFS) between ALL that does/ does not have CDKN2A/2B gene deletions. Subgroup analysis highlighted poorer prognosis among hepatosplenomegaly patients in the CDKN2A/2B gene deletion group, with a 5-year EFS of 81.8%, 95%CI (0.695-0.963), P = 0.05. Hepatosplenomegaly emerged as the most significant prognostic factor for EFS [HR = 2.306, 95%CI (1.192-4.461), P = 0.013]. Cox regression analyses identified covariates influencing prognosis, ALL with the CDKN2A/2B gene showing no significant impact on outcomes. In conclusion, while ALL that does have CDKN2A/2B gene deletions is associated with certain clinical characteristics and genetic aberrations, they did not significantly impact OS or EFS. Furthermore, subgroup analysis revealed a potential prognostic role of ALL that does have CDKN2A/2B deletions presenting with hepatosplenomegaly on palpation, emphasizing the importance of comprehensive risk stratification in treatment decision-making for this subgroup.

Background: Relapsed/Refractory (R/R) diffuse large B-cell lymphoma (DLBCL) represents a subgroup with a high incidence and dismal prognosis. Currently, there is a lack of robust models for predicting R/R DLBCL. Therefore, we conducted a retrospective study to identify key determinants to be incorporated into a novel nomogram to enhance the identification of DLBCL patients at elevated risk of refractoriness/recurrence.

Methods: We included 293 newly-diagnosed DLBCL patients from Harbin Medical University Cancer Hospital, collected from 2008-2017. Patients were randomly divided into a training cohort (n = 206) and a validation cohort (n = 87) at a 7:3 ratio. The training cohort underwent univariable analysis to select variables for a binary logistic regression model. These variables were also prioritized using a random forest algorithm. The developed nomogram was evaluated with the receiver-operator characteristic (ROC) curve, calibration curve, and decision curve analysis (DCA) for its clinical utility.

Results: Univariable analysis pinpointed several factors significantly associated with refractoriness/recurrence, including pathological subtype, lactate dehydrogenase (LDH), International Prognostic Index (IPI), treatment, absolute lymphocyte count (ALC), lymphocyte/monocyte ratio (LMR), and prognostic nutritional index (PNI). Binary logistic regression highlighted pathological subtype, LDH, treatment, and ALC as key predictors, which were incorporated into the nomogram. The nomogram showed excellent calibration and accuracy in both cohorts, and comparative DCA and ROC analysis demonstrated its superior net benefit and area under the curve (AUC) compared to traditional indexes like IPI, R-IPI, and NCCN-IPI.

Conclusion: This nomogram serves as a valuable tool for predicting the likelihood of refractoriness or recurrence in DLBCL patients.

Objective: Liquid-liquid phase separation (LLPS) may affect the therapeutic sensitivity of multiple myeloma (MM). This study aimed to identify LLPS-related genes with MM prognostic values and to confirm their effects on tumor progression.

Methods: Based on public transcriptomic data, this study screened LLPS- and immune-related genes for MM-derived plasma cells. Subtypes were identified using consensus clustering, followed by comparisons using t-test and survival analysis. Least absolute shrinkage and selection operator was implemented to screen prognostic signatures, and Kaplan-Meier and receiver operator characteristic curves were plotted to assess their prognostic values. After transfected with sh-DDX21, CCK8, flow cytometry, and Transwells were used to observe MM cell proliferation, apoptosis, migration, and invasion.

Results: By overlapping LLPS- and immune-related genes, 103 genes were obtained to cluster MM samples into three subtypes, which had significant differences in survival and immune landscape. Cox regression analysis screened out EZH2 and DDX21 that significantly overexpressed in MM to construct a prognostic model, with superior performance in predicting MM prognostic risks. Notably, subtype2 with more adverse prognosis showed significantly elevated risk scores and was more distributed in groups with high prognostic risk. In vitro experiments confirmed that cell proliferation, invasion, and migration were significantly inhibited in MM.1S cells transfected with sh-DDX21.

Conclusion: LLPS-related EZH2 and DDX21 were novel markers to predict prognostic risk of MM. Among them, DDX21 was experimentally confirmed to promote MM cell proliferation, migration and invasion. These potential prognostic markers could be targeted in future personalized therapeutic strategies for MM, potentially improving patient outcomes.

Objectives: Currently, there is limited understanding regarding the prognostic significance of time to progression (TTP) after first remission in multiple myeloma (MM).

Methods: We conducted a retrospective analysis of clinical data from 209 patients with MM. These patients were categorized into ≤ 6 months, ≤ 12 months, ≤ 24 months, > 24 months, 6-12 months, and 12-24 months subgroups based on TTP.

Results: Patients in ≤ 12 months group exhibited shorter median overall survival (OS) and OS-1 compared to those in ≤ 24 months group (61.73 vs 96.10 months, P = 0.02; 54.00 vs 74.17 months, P = 0.048). ≤ 6 months group exhibited shorter median OS and OS-1 compared to 6-12 months group (33.63 vs 79.60 months, P = 0.022; 19.93 vs 65.17 months, P = 0.015). Patients in 6-12 months group had shorter median OS and OS-1 compared to those in 12-24 months group (79.60 vs 100.43 months, P < 0.001; 65.17 vs 77.17 months, P = 0.012).No significant difference in OS was observed between patients in 12-24 months and > 24 months groups. For patients who experienced progression within 12 or 24 months after remission, undergoing autologous hematopoietic stem cell transplantation (ASCT) after progression conferred a median OS and OS-2 advantage over receiving post-progression chemotherapy. Multivariable analysis confirmed that TTP was an independent predictor for OS in patients with MM.

Conclusion: Patients with MM who experience earlier disease progression within 12 months after remission have a worse prognosis, and post-progression ASCT can improve their survival outcomes.

To investigate the role of ALKBH3 in acute myeloid leukemia (AML), we constructed an animal model of xenotransplantation of AML. Our study demonstrated that ALKBH3-mediated m1A demethylation inhibits ferroptosis in KG-1 cells by increasing ATF4 expression, thus promoting the development of AML. These findings suggest that reducing ALKBH3 expression may be a potential strategy to mitigate AML progression.

Background: Acute myeloid leukemia (AML) is characterized by the unrestrained proliferation of myeloid cells. Studies have shown that ALKBH3 is upregulated in most tumors, but the role of ALKBH3 in AML remains unclear.Methods: In this study, we investigated the function of ALKBH3 in AML cells (KG-1) by immunofluorescence, ELISA, flow cytometry, HE staining, and Western blotting.Results: Our results revealed that ALKBH3 is upregulated in AML and that the downregulation of ALKBH3 inhibited KG-1 cell proliferation and promoted cell apoptosis; at the same time, ALKBH3 upregulated ATF4 expression through m1A demethylation, and the knockdown of ATF4 resulted in increased ferrous iron content; TFR1, ACSL4, and PTGS2 expression; and ROS and MDA levels, whereas SOD and GSH levels and the expression levels of ATF4, SLC7A11, GPX4, and FTH1 decreased in KG-1 cells, thereby promoting ferroptosis. Mechanistically, ALKBH3-mediated m1A demethylation suppressed ferroptosis in KG-1 cells by increasing ATF4 expression, thereby promoting the development of AML.Conclusions: Our study indicated that reducing the expression of ALKBH3 might be a potential target for improving AML symptoms.

Objective: This review aimed to examine if there is any difference in the risk of thrombosis and central line-associated bloodstream infection (CLABSI) with the use of peripherally inserted central catheter (PICC) and conventional central venous catheters (CVC) in hematological cancer patients.

Methods: We searched the online databases of PubMed, CENTRAL, Scopus, Web of Science, and Embase for all types of studies comparing the risk of thrombosis and CLABSI between PICC and CVC. The search ended on 23rd September 2024.

Results: Eight studies were included. One was a randomized trial while others were observational studies. Meta-analysis showed no statistically significant difference in the risk of thrombosis between PICC and CVC (OR: 1.69 95% CI: 0.75, 3.82 I²= 78%). However, these results were not stable on sensitivity analysis. The exclusion of two studies indicated a higher risk of thrombosis with PICC. Pooled analysis showed that the risk of CLABSI was significantly lower with PICC as compared to CVC (OR: 0.52 95% CI: 0.40, 0.66 I²= 0%). Results of subgroup analysis based on study design and diagnosis showed conflicting results.

Conclusions: There is conflicting evidence on the risk of thrombosis between PICC and CVC when used for hematological cancer patients. There could be a tendency of higher risk of thrombosis with PICC which needs to be confirmed by further studies. However, the use of PICC may reduce the risk of CLABSI in such patients. The quality of evidence is low owing to the predominance of observational studies with high inter-study heterogeneity.