Hematology最新文献

Objectives: Controlling Nutritional Status (CONUT) Score is an effective tool for the assessment of malnutrition and proved to be associated with survival of Diffuse large B-cell lymphoma (DLBCL) patients. We investigated the impact of CONUT score on specific subgroups of DLBCL patients, including age and International prognostic Index (IPI) risk groups.

Methods: Data of 287 newly diagnosed DLBCL in the Third Affiliated Hospital of Soochow University were retrospectively collected. Baseline CONUT score, clinical data and survival information were recorded.

Results: With the standard cut-off value of 4 points, 88 (30.7%) patients were clarified as malnourished. During a median follow-up of 34 months, malnourished patients exhibited significant reduction in both progression-free survival (PFS) and overall survival (OS). The 3-year PFS rates for malnourished and well-nourished patients were 51.4% and 70.9% (p = 0.001), while the 3-year OS rates were 62.4% and 84.0% (p < 0.001). Malnutrition was demonstrated an independent predictor of OS in DLBCL patients (HR 2.220, 95% CI 1.307-3.772, p = 0.003). It could effectively identify patients with inferior OS in both low/intermediate-low risk and intermediate-high/high risk IPI groups. In the group of elderly patients aged over 60 years, malnutrition was independently associated with OS (HR 2.182, 95% CI 1.178-4.040, p = 0.024), but not PFS (HR 1.709, 95% CI 1.016-2.875, p = 0.070) after adjustment using the Benjamini-Hochberg procedure. Conversely, for younger patients, malnutrition did not demonstrate an independent impact on either PFS or OS.

Conclusion: Malnutrition evaluated by CONUT score was an independent predictor for the outcome of DLBCL patients, which is exclusively caused by its effect on elderly patients.

Objective: Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

Methods: The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

Results: The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

Conclusions: We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

In this retrospective case-control study involving 424 pediatric patients diagnosed with Pediatric Acute Lymphoblastic Leukemia (ALL), the investigation focused on analyzing the clinical characteristics and prognosis associated with the Cyclin-dependent kinase inhibitor 2A/2B (CDKN2A/2B) gene. Treatment and evaluation followed the South China Children's Leukemia Group-ALL-2016 protocol (SCCLG-ALL-2016). Among the cohort, 92 patients (21.7%) exhibited CDKN2A/2B gene deletions, with 11.1% homozygous and 10.6% heterozygous deletions. Notably, ALL patients that do have CDKN2A/2B gene deletions tended to present at an older age (P = 0.001), demonstrate hepatosplenomegaly on palpation (P < 0.001), and exhibit a higher incidence of Central nervous system leukemia (CNSL) (P = 0.037) and T-ALL (P = 0.007). A significant correlation was observed between ALL that does have CDKN2A/2B gene deletions and ETV6::RUNX1-positive (8.7% vs. 19.3%, P = 0.017) and IKZF1 gene deletions (20.7% vs. 8.4%, P = 0.001). Survival analysis of 392 patients revealed no significant differences in 5-year relapse, Overall survival (OS), or Event-free survival (EFS) between ALL that does/ does not have CDKN2A/2B gene deletions. Subgroup analysis highlighted poorer prognosis among hepatosplenomegaly patients in the CDKN2A/2B gene deletion group, with a 5-year EFS of 81.8%, 95%CI (0.695-0.963), P = 0.05. Hepatosplenomegaly emerged as the most significant prognostic factor for EFS [HR = 2.306, 95%CI (1.192-4.461), P = 0.013]. Cox regression analyses identified covariates influencing prognosis, ALL with the CDKN2A/2B gene showing no significant impact on outcomes. In conclusion, while ALL that does have CDKN2A/2B gene deletions is associated with certain clinical characteristics and genetic aberrations, they did not significantly impact OS or EFS. Furthermore, subgroup analysis revealed a potential prognostic role of ALL that does have CDKN2A/2B deletions presenting with hepatosplenomegaly on palpation, emphasizing the importance of comprehensive risk stratification in treatment decision-making for this subgroup.

Objectives: This study aims to investigate the serotransferrin (TF), complement C1s subcomponent (C1S), immunoglobulin heavy constant gamma 4 (IGHG4), hemoglobin subunit alpha (HBA1), and clusterin (CLU) contents in β-thalassemia patients, and explores their physiological role as potential non-invasive bioindicators for disease diagnosis and iron overload.

Methods: A total of 62 children with β-thalassemia were recruited and categorized by genotype, along with 17 healthy pediatric volunteers for analysis. The circulating ferritin content was evaluated, and plasma levels of TF, C1S, IGHG4, HBA1, and CLU were assessed using ELISA. The primary outcome of this study was the correlation between the five protein marker levels and iron overload. Continuous variables were analyzed using the Student's t-test or the Mann-Whitney U test. A binary logistic regression model identified independent predictors of iron overload in patients with β-thalassemia. Receiver operating characteristics (ROC) were employed to evaluate the model's performance.

Results: The IGHG4 protein content was significantly lower in β-thalassemia patients compared to healthy controls. The IGHG4 protein content was reduced in the β⁺/β⁰ and β⁰/β⁰ patient populations compared to controls, with no significant difference observed between the β⁺/β⁰ group and healthy controls. A strong inverse relationship was identified between the IGHG4 protein content and SF concentration (r = -0.322, p = 0.004). Finally, plasma IGHG4 levels demonstrated adequate diagnostic capability, as indicated by our ROC curve analysis.

Conclusion: In conclusion, decreased IGHG4 protein levels are significantly associated with the degree of iron overload in β-thalassemia patients and may serve as a possible biomarker for evaluating iron overload.

Background: Survival outcomes of Pediatric Acute Lymphoblastic Leukemia (ALL) in the developing world have lagged. Here we report improved outcomes of pediatric ALL from India.Methods: We analyzed outcomes of children with ALL treated at our center between 2016 and 2021. They were treated as per the modified BFM 95 protocol with Minimal Residual Disease (MRD) monitoring by flow cytometry (FCM).Results: We diagnosed and managed 68 patients, 57 being Precursor B (Pre B) cell ALL and the rest of T cell ALL. With BFM 95 protocol-based risk stratification, 19/68, 44/68 and 3/68 patients were Standard risk (SR), Medium risk (MR) and High risk (HR), respectively and 2/68 were not stratified due to Induction mortality. With MRD-based risk stratification, 52/68, 11/68 and 2/68 patients fell in the SR, MR and HR category, respectively and 3/68 patients were not classifiable by MRD (2 Induction deaths and 1 refractory disease) and 65/68 patients achieved morphological complete remission (CR) at the end of Induction. Five out of 68 ALL patients underwent allogeneic hematopoietic stem cell transplant (HSCT) in CR1. Ten out of 68 patients had a relapse, 6 of whom are alive and in CR2 till the last follow-up. The mean duration of follow-up was 1150 days (median 1219 days). Treatment-related mortality was 4.4% in our cohort. The Event Free Survival (EFS) of our cohort was 79.4% and Overall Survival (OS) was 88.2% at a median follow-up of 1219 days.Conclusion: Survival outcomes have improved for children with ALL with modifications in BFM 95 protocol and incorporation of MRD assessment.

Introduction: KMT2A rearrangement (KMT2Ar) is a common genomic alteration in acute leukemia that can be effectively targeted by menin inhibitors. While FISH is the standard laboratory test for KMT2Ar, false positives can occur.

Case report: We present a case of AML in which both RUNX1::RUNX1T1 and KMT2Ar were identified by karyotype analysis and FISH. Although a targeted RNA next generation sequencing (NGS) assay confirmed the presence of the RUNX1::RUNX1T1 fusion, it did not detect a KMT2A fusion transcript. To investigate the discrepancy between the positive KMT2A FISH result and the negative fusion transcript, we performed whole-genome mate-pair DNA NGS to examine the KMT2A locus on chromosome 11q23. This analysis revealed a breakpoint located 5.8 kb downstream of KMT2A, which did not disrupt the gene itself. Given that KMT2A FISH probes cover approximately 1 Mb around KMT2A, this subtle shift led to a split-apart signal pattern mimicking a genuine KMT2A rearrangement, resulting in a false positive FISH interpretation.

Conclusion: This case highlights a false positive KMT2Ar in primary AML, indicating the need for additional molecular testing for confirmation.

Objectives: The combination of Venetoclax (VEN) and Azacitidine (AZA) increases survival outcomes and yields excellent responses in patients with acute myeloid leukemia (AML). However, dose reduction (or discontinuation) is commonly encountered due to therapy-related toxicity. Thus, this study aimed to investigate the efficiency and safety of a lower dosage of venetoclax for the treatment of AML.

Methods: This observational study analyzed the characteristics and outcomes of newly diagnosed AML patients who received 100 mg VEN combined with AZA for 14 days at our institution.

Results: A total of 36 patients were enrolled, and the median age at diagnosis was 64 years. After a median follow-up of 15 (range 4-29) months, the median overall survival (OS) and progression-free survival (PFS) for the whole cohort were 17 (4-29) months and 12 (1-28) months, respectively. Meanwhile, the overall response rate (ORR) was 69.4%, and the CRc rate was 66.7% in the whole cohort. Subgroup analysis revealed that NPM1 mutations and FAB-M5 subtype were associated with higher response rates, whereas the adverse ELN risk group was predictive of an inferior response. Moreover, ASXL1, NPM1, and IDH1/2 mutations negatively impacted PFS.

Discussion: Our study optimized the administration of venetoclax plus azacytidine for the treatment of AML patients. Response rates were favorable, with median survival in agreement with the findings of earlier reports, offering valuable insights for optimizing VEN-based regimens.

Conclusion: In summary, the VEN combination regimen is effective for the treatment of newly diagnosed AML patients in the real world despite VEN dose reductions .

Objectives: Acute myeloid leukemia (AML) is one of the common hematological diseases with low survival rates. Studies have highlighted the dysregulated expression of immune-related and exosome-related genes (ERGs) in cancers. Nevertheless, it remains to be determined whether combining these genes have a prognostic significance in AML.

Methods: Immune-ERG profiles for 151 AML patients from TCGA were analyzed. A risk model was constructed and optimized through the combination of univariate Cox regression and LASSO regression analysis. GEO datasets were utilized as the external validation for the robustness of the risk model. In addition, we performed KEGG and GO enrichment analyses to investigate the role played by these genes in AML. The variations in immune cell infiltrations among risk groups were assessed through four algorithms. Expression of hub gene in specific cell was analyzed by single-cell RNA seq.

Results: A total of 85 immune-ERGs associated with prognosis were identified, enabling the construction of a risk model for AML. The risk model based on five immune-ERGs (CD37, NUCB2, LSP1, MGST1, and PLXNB1) demonstrated a correlation with the clinical outcomes. Additionally, age, FAB classification, cytogenetics risk, and risk score were identified as independent prognostic factors. The five immune-ERGs exhibited correlations with cytokine-cytokine receptor interaction, and antigen processing and presentation. Notably, the risk model demonstrated significant associations with immune responses and the expression of immune checkpoints.

Conclusions: An immune-ERG-based risk model was developed to effectively predict prognostic outcomes for AML patients. There is potential for immune therapy in AML targeting the five hub genes.

Objectives: The TP53 mutation, a prevalent tumor suppressor gene alteration, is linked to chemotherapy resistance, increased relapse rates and diminished overall survival (OS) in acute myeloid leukemia (AML) patients.

Methods: In this study, we characterize the TP53 mutation phenotypes across various AML cohorts utilizing The Cancer Genome Atlas (TCGA) data. We devised a TP53-related prognostic signature derived from differentially expressed genes between mutated and wild-type TP53 AML specimens. In-depth analyses were conducted, encompassing genetic variation, immune cell infiltration and prognostic stratification.

Results: A six-gene TP53-related signature was established using least absolute shrinkage and selection operator (LASSO)-Cox regression, demonstrating robust prognostic predictability. This signature exhibited strong performance in both the OHSU validation cohorts, an independent Gene Expression Omnibus (GEO) validation cohort (GSE71014) and proved by results of the in vivo experiment. Finally, we used single cell database (GSE198681) to observe the characteristics of these six genes.

Discussion: Our study may facilitate the development of efficacious therapeutic approaches and provide a novel idea for future research. Conclusion: The TP53-related signature and pattern hold the potential to refine prognostic stratification and underscore emerging targeted therapies.

Acute myeloid leukemia (AML), which has distinct genetic abnormalities, has unique clinical and biological features. In this study, the incidence, clinical characteristics, induction treatment response, and outcomes of a large cohort of Chinese AML pediatric patients treated according to the BCH-AML 2005 protocol were analyzed. RUNX1-RUNX1T1 was the most common fusion transcript, followed by the CBFβ-MHY11 and KMT2A rearrangements. FLT3-ITD and KIT mutations are associated with unfavorable clinical features and induction responses, along with KMT2A rearrangements, DEK-NUP214, and CBF-AML. The 5-year event-free survival (EFS) and overall survival (OS) rates of our cohort were 53.9 ± 3.7% and 58.5 ± 3.6%, with the best survival found among patients with CBFβ-MYH11 and the worst survival among those with DEK-NUP214. In addition, we found that patients with FLT3-ITD mutation had adverse outcomes and that KIT mutation had a negative impact on OS in RUNX1-RUNX1T1⁺ patients. Furthermore, the risk classification and response to treatment after each induction block also influenced the prognosis, and HSCT after first remission could improve OS in high-risk patients. Not achieving complete remission after induction 2 was found to be an independent prognostic factor for OS and EFS. These findings indicate that genetic abnormalities could be considered stratification factors, predict patient outcomes, and imply the application of targeted therapy.