Hematology最新文献

Objectives: Prior research has highlighted immune cells' critical role in multiple myeloma (MM) pathogenesis, yet the causal relationships between them have remained obscure.

Methods: We utilized data from genome-wide association studies (GWAS) of European cohorts to conduct a Mendelian Randomization (MR) analysis, aiming to establish causal links between immune cell phenotypes and MM. We selected single nucleotide polymorphisms (SNPs) associated with immune cell traits at a suggestive significance threshold (P < 1 × 10^-5) to ensure sufficient instrumental variables, with F-statistics (>10) calculated to assess instrument strength. Multiple MR methods were applied to 731 immune phenotypes and MM.

Results: Eight immunophenotypes showed nominal associations with MM risk (P < 0.05). However, no associations survived the strict Bonferroni correction for multiple testing. Suggestive causal effects of MM on immunophenotypic traits are predominantly negative, implying that MM may impair the functionality of immune cells.

Discussion: This study uses GWAS data to elucidate the genetic impact of immune cells on the initiation and progression of MM. It presents genetic evidence suggesting that immune cells could alter MM risk based on a thorough genetic analysis. Bidirectional two-sample MR identified eight distinct immunophenotypes (encompassing four immune signatures: MFI, RC, AC, MP) with causal effects on MM.

Conclusion: Our study provides preliminary evidence for potential causal links between specific immune traits and MM risk. Independent replication in larger cohorts and functional validation are warranted given the nominal significance of these associations, which may inform future immunotherapeutic investigations. These findings contribute to a better understanding of the complex immune - MM interplay and may guide future investigations into immunotherapeutic approaches.

Introduction: Blood is vital for life, but ensuring a safe and sufficient supply remains a public health challenge, particularly in low-resource settings. This study explores the knowledge, attitudes, practices, and factors influencing blood donation among pre-service teacher trainees at Finote Selam College of Education, Northwest Ethiopia.

Methods: A cross-sectional survey was conducted using proportionate sampling. Data were collected through questionnaires completed by the participants themselves and analyzed using SPSS version 27, with results presented in descriptive narratives and tables.

Results: Of 277 participants, 27.8% were male and 72.2% female. While 55.6% demonstrated adequate knowledge of blood donation and 42.2% had a positive attitude, only 28.2% had ever donated blood. Key factors influencing donation practices included knowledge, attitude, academic department, and religious affiliation.

Conclusion: Although participants had reasonable knowledge of blood donation, positive attitudes and actual donation rates were low. Department-specific awareness programs and regular donation drives, in partnership with health institutions, could enhance donation rates and foster social responsibility among future educators.

Objectives: This study aimed to compare clinical, and molecular features between acute myeloid leukemia (AML) patients aged <50 and ≥50 years, while also assessing their respective treatment outcomes and prognostic factors.

Methods: We conducted a retrospective analysis of clinical data from AML patients treated at our institution between October 2015 and June 2021, supplemented by data extracted from the SEER database spanning 2000 to 2019. Survival outcomes were evaluated using Kaplan-Meier methodology.

Results: In patients aged ≥50 years, we observed higher prevalence of DNMT3A, IDH2, and TP53 mutations along with -5/del (5q) karyotype abnormalities. The treatment outcomes were suboptimal, with a complete response (CR) rate of 45.9%, relapse rate of 60.8%, and two-year overall survival (OS) rate of 33.3%. VEN-treated chemotherapy-intolerant patients showed significantly improved two-year OS (36.0% vs 12.1% in non-VEN group; P = 0.006). In contrast, patients aged <50 years exhibited a distinct molecular profile characterized by a predominance of NRAS, biallelic CEBPA, WT1, and C-KIT mutations, along with a higher incidence of RUNX1-RUNX1T1 and CBFB-MYH11 fusion genes. This group demonstrated more favorable clinical outcomes, with a CR rate of 73.1%, relapse rate of 36.8%, and two-year OS rate of 68.3%.

Conclusions: This study revealed that patients aged ≥50 years displayed more complex genetic aberration profiles and experienced significantly poorer prognoses compared to their younger counterparts. These findings provided novel insights for optimizing treatment strategies for middle-aged and elderly AML patients in the Chinese population.

Objective: To identify simple clinical predictors of prognosis in multiple myeloma (MM) after chemotherapy and assess their predictive value.

Methods: We retrospectively analyzed 164 newly diagnosed MM patients treated with proteasome inhibitor- and/or immunomodulatory drug-based chemotherapy between 2018 and 2024. Baseline data included demographics, DS/ISS stage, haemoglobin (Hb), platelets, albumin, creatinine, calcium, lactate dehydrogenase (LDH), erythrocyte sedimentation rate, and serum β2-microglobulin (β2-MG). Treatment responses after four cycles (CR/VGPR vs ≤PR) and survival outcomes were recorded. Overall survival (OS) and progression-free survival (PFS) were estimated by Kaplan-Meier analysis. Cox models identified independent prognostic factors. Landmark 2-year ROC curves evaluated discriminative ability.

Results: After four cycles, 95/164 patients (57.9%) achieved CR/VGPR and 69 (42.1%) ≤PR. During a median follow-up of 31 months, 85 deaths and 112 progression events occurred. Multivariable analysis showed that age >60 years, Hb ≤85 g/L, β2-MG>3.5 mg/L, and ≤PR were independently associated with shorter OS, whereas Hb ≤85 g/L and ≤PR predicted shorter PFS. Two-year AUCs for mortality prediction were 0.601 for age, 0.624 for Hb, 0.647 for β2-MG, and 0.731 for response; for PFS prediction, AUCs were 0.668 for Hb and 0.749 for response, indicating fair but limited standalone discrimination.

Conclusion: Advanced age, severe anaemia, elevated β2-MG, and suboptimal early response are simple, readily available predictors of adverse survival in MM. Although their individual discriminative power is modest, these factors may inform pragmatic risk stratification, especially where cytogenetic and MRD testing are unavailable, and could be incorporated into future composite prognostic scores.

Background: Platelet concentrates play an important role in clinical treatment such as platelet function disorders and thrombocytopenia. In the process of preparation and storage of platelets, centrifugation, leukofiltration, and agitation will cause morphological changes and impaired function of platelets, which is associated with the increase of platelet transfusion refractoriness, and named as platelet storage lesion (PSL).

Method: This paper proposes three major operations (centrifugation, agitation, and leukofiltration) that platelets experience during the preparation and storage process, to explore the effect of physical cues on PSL. The analysis of morphology, metabolism index, and levels of activation markers are used to monitor the quality of stored platelets and definite the role of physical cues in PSL.

Result: In this study, centrifugation, leukofiltration and agitation lead to different degrees of platelet activation, with the extension of storage time. At one hour after separation, PSL can be found through structural change, metabolic parameters, and activation markers of platelets. Agitation maintains more cell numbers, better cell morphology, and lower metabolism rate in platelets, and keeps the low activation state of platelets throughout the storage period. The hard centrifugation group showed the highest level of CD62P expression throughout the storage.

Conclusion: our results indicate that agitation can mitigate PSL by supplying sufficient O₂ during preservation, shear stress may cause PSL immediately after the physical cues were applied; however, hydrostatic pressure induced by filtration is negligible for its effects on PSL. Meanwhile, when the physical cues are big enough, the activation of platelets is irreversible, such as spin at 2000 g. The granule secretion of platelets is a kind of irreversible activation; however, the membrane reorganization of platelets is a kind of reversible activation.

Background: Iron deficiency anemia (IDA) is the most common cause of anemia worldwide. Patients with IDA often present thrombocytosis, but little is known about its degree and prevalence, and its response to iron replacement.

Methods: We conducted a retrospective review of 76 consecutive patients with anemia secondary only to iron deficiency. Laboratory data were collected both at baseline and at 3 months after either oral or intravenous iron replacement therapy. We defined thrombocytosis as a platelet count >400 × 10⁹/L.

Results: The median age of the patients was 54 years (range, 22-90 years), and 59 of 76 (78%) patients were females. The replacement therapy consisted of oral iron (n = 13), intravenous iron (n = 33), or both (n = 30). The median Hb and ferritin levels at baseline and at 3 months after the iron replacement were 9.9 g/dL and 18 mg/dL, and 12.4 g/dL (p < 0.0001) and 113 mg/dL (p < 0.0001), respectively. Thrombocytosis before and after the iron administration was present in 17 (22%) and 4 (5%) patients, respectively. Regardless of thrombocytosis, the platelet count decreased in 55 (72%) patients. The median platelet level at baseline and at 3 months after the iron replacement was 299 (95% CI, 276-330) and 265 (95% CI, 245-295) × 10⁹/L (p < 0.0001), respectively.

Conclusion: Thrombocytosis is found in about one fifth of patients with IDA at baseline, and it is expected to resolve within 3 months of iron replacement therapy in most of them. Iron administration is associated with a decrease of the platelet counts, even in the absence of preexisting thrombocytosis.

Background: While there has been no direct head-to-head comparison, it is assumed that second-line treatment with dasatinib and nilotinib has comparable efficacy but distinct safety profiles in the treatment of patients with chronic phase chronic myeloid leukemia (CML-CP). Our aim was to conduct a real-world analysis to compare the efficacy and safety profiles of these two agents.

Methods: Data from 73 CML-CP patients, who received either dasatinib or nilotinib in second-line treatment, were analyzed. The primary interest of the efficacy assessment was a major molecular response (MMR) at the 12-month, 5-year cumulative incidence of treatment failure, and overall survival.

Results: A total of 73.5% of 34 patients in the dasatinib and 76.9% of 39 patients in the nilotinib group achieved MMR at 12 months. Five-year cumulative probability of treatment failure in patients, who previously achieved MMR was 0 and 7.6% for patients receiving dasatinib and nilotinib, respectively (p = 0.25). Eight-year OS was 82.7 and 86.3% for dasatinib and nilotinib groups, respectively (p = 0.90). Pleural effusions were more common in the dasatinib group, leading to treatment discontinuation, while cardiovascular events and thrombotic incidents were more prevalent in the nilotinib group.

Conclusion: Dasatinib and nilotinib exhibit similar efficacy in the CML-CP treatment. Individualized patient management should consider patient comorbidities and safety profiles.

Background: The health implications of trace elements have become increasingly concerning, yet the connection between blood manganese levels and anemia remains insufficiently examined. This research endeavors to explore the potential linkage between blood manganese concentrations and anemia.

Methods: Utilizing data from the National Health and Nutrition Examination Survey (NHANES) from 2011 to 2018, this study examines the correlation between blood manganese levels and anemia among U.S. adults, offering a comprehensive national perspective. The study included 11,300 adults aged 20 and above, with both blood manganese and hemoglobin levels measured. Generalized Additive Model (GAM) was applied to delineate smooth curves, and threshold effect analysis was performed to identify the inflection points of these curves. Subsequently, unconditional logistic regression was employed to assess the risk.

Results: Our research involved a total of 11,300 individuals, among which 1,143 (10.1%) were identified with anemia. The curve fitting analysis indicated a U-shaped relationship between blood manganese levels and the risk of anemia. Specifically, when blood manganese levels were below 8.69 µg/L, increasing concentrations were linked to a decreased risk of anemia, with an adjusted OR of 0.838 (95% CI: 0.735-0.954), indicating a protective effect of this level of blood manganese against anemia. Conversely, when blood manganese levels were at or above 8.69 µg/L, further elevations were strongly associated with an increased risk of anemia, with the adjusted OR rising to 1.160 (95% CI: 1.124-1.196), suggesting that excessively high blood manganese levels significantly raised the risk of developing anemia.

Conclusion: This study provides novel insights into the association between blood manganese levels and anemia. Further extensive, population-based cohort studies are necessary to validate the causality and to uncover the intrinsic toxicological mechanisms.

Background: This study investigates the expression and clinical significance of the histamine receptor family (HRs) in the bone marrow of children with newly diagnosed acute myeloid leukemia (AML).

Methods: RNA sequencing was performed to assess the expression levels of HR family members (HRH1, HRH2, HRH3, and HRH4) in the bone marrow of 140 pediatric AML patients prior to chemotherapy. We compared the expression levels across various risk categories and assessed their relationship with prognosis using ROC curve analysis to evaluate predictive capabilities for outcomes.

Results: Among the 140 AML patients in our center, those with different FAB subtypes showed varying overall survival (OS), event-free survival (EFS), and relapse-free survival (RFS). Specifically, the M2 and M4 subtypes showed better OS, EFS, and RFS, whereas the M5 subtype had poorer outcomes. Among patients with different fusion genes, those with AML1/ETO had superior OS, EFS, and RFS compared to other subtypes. Additionally, patients with CEBPA mutations demonstrated relatively favorable outcomes, whereas those with FLT3 mutations had poorer survival metrics. HRH1 expression was significantly higher in AML patients than in normal controls (P < 0.05). Patients in the high HRH1 expression group had significantly better EFS and RFS than those in the low expression group (P < 0.05). Furthermore, HRH1 expression was significantly higher in the low-risk (LR) group than in the intermediate and high-risk (IR & HR) groups (P < 0.05). This finding suggests that HRH1 may serve as an early predictor of risk, EFS, and RFS.

Conclusion: The clinical significance of HR family members varies in pediatric AML, with HRH1 identified as a valuable predictor of relapse in children with AML.

Objective: Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

Methods: The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

Results: The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

Conclusions: We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.