Hematology最新文献

Objective: Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

Methods: The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

Results: The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

Conclusions: We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

Allogeneic hematopoietic stem cell transplantation (Allo-HSCT) remains the mainstay of treatment for adults with high-risk acute lymphoblastic leukemia (ALL). Due to the crucial role of measurable residual disease (MRD) before Allo-HSCT in predicting relapse and the promising anti-leukemia effect of blinatumomab, we documented a short-course, low-dose conditioning regimen incorporating blinatumomab for Allo-HSCT in three ALL patients with positive MRD. Following the administration of the blinatumomab-containing conditioning regimen, all patients attained complete remission (CR) with negative MRD status, and no severe adverse events were observed. After a 2-year follow-up, 2/3 of patients remained disease-free and attained long-term survival following transplantation. These cases indicated a short-term blinatumomab conditioning regimen may effectively prolong patient survival, improve prognosis, and offer a safe and cost-effective treatment for high-risk ALL patients with positive MRD. The addition of blinatumomab to the conditioning regimen of Allo-HSCT is feasible for high-risk ALL patients with positive MRD.

Objectives: Controlling Nutritional Status (CONUT) Score is an effective tool for the assessment of malnutrition and proved to be associated with survival of Diffuse large B-cell lymphoma (DLBCL) patients. We investigated the impact of CONUT score on specific subgroups of DLBCL patients, including age and International prognostic Index (IPI) risk groups.

Methods: Data of 287 newly diagnosed DLBCL in the Third Affiliated Hospital of Soochow University were retrospectively collected. Baseline CONUT score, clinical data and survival information were recorded.

Results: With the standard cut-off value of 4 points, 88 (30.7%) patients were clarified as malnourished. During a median follow-up of 34 months, malnourished patients exhibited significant reduction in both progression-free survival (PFS) and overall survival (OS). The 3-year PFS rates for malnourished and well-nourished patients were 51.4% and 70.9% (p = 0.001), while the 3-year OS rates were 62.4% and 84.0% (p < 0.001). Malnutrition was demonstrated an independent predictor of OS in DLBCL patients (HR 2.220, 95% CI 1.307-3.772, p = 0.003). It could effectively identify patients with inferior OS in both low/intermediate-low risk and intermediate-high/high risk IPI groups. In the group of elderly patients aged over 60 years, malnutrition was independently associated with OS (HR 2.182, 95% CI 1.178-4.040, p = 0.024), but not PFS (HR 1.709, 95% CI 1.016-2.875, p = 0.070) after adjustment using the Benjamini-Hochberg procedure. Conversely, for younger patients, malnutrition did not demonstrate an independent impact on either PFS or OS.

Conclusion: Malnutrition evaluated by CONUT score was an independent predictor for the outcome of DLBCL patients, which is exclusively caused by its effect on elderly patients.

Purpose: This study was designed to investigate the relationship between peripheral blood inflammatory markers and prognosis in MDS patients.

Methods: We conducted a study involving 183 MDS patients who were diagnosed at Taizhou Hospital of Zhejiang Province and Enze Hospital between January 2015 and December 2019. The end point of follow-up was September 2022. To minimize the impact of other confounding factors among the 110 included MDS patients, X-tile software was used to determine the optimal cutoff points for peripheral blood inflammation markers. Based on these cutoff points, the cohort of patients was divided into a high-risk group and a low-risk group. The OS in each group was analyzed by the Kaplan-Meier method, and univariate and multivariate Cox regression analyses were employed.

Results: The MDS patients included 73 men and 37 women with a median age of 72 years (32-92 years). The median OS was 28 months (1-83 months), 17 patients (15.45%) experienced conversion to AML, and 94 patients (85.45%) died during the follow-up period. The optimal cutoff points were ALC (1.2 × 10⁹/L), AMC (0 × 10⁹/L), CRP (6.1 mg/L), MLR (0.125), NLR (2.25) and PLR (71.4). Patients in the ALC (≤1.2 × 10⁹/L, P = 0.017), MLR (>0.125, P = 0.01), PLR (>71.43, P = 0.044), and CRP (>6.1 mg/L, P < 0.0001) groups had shorter overall survival. The MLR (>0.125, P = 0.011) and CRP (>6.1 mg/L, P = 0.017) levels were related to poor prognosis.

Conclusions: Elevated MLR and CRP levels may be independent indicators of poor prognosis in newly diagnosed MDS patients.

Background: The current study aimed to compare treatment responses, the incidence of the need for auto-HSCT, and the occurrence of specific adverse events (AEs) between VTD and velcade, VRD induction regimens in patients with transplant-eligible newly diagnosed multiple myeloma (NDMM).

Methods: This systematic review and meta-analysis included 15 studies: six evaluating the VTD regimen and nine evaluating the VRD one. The primary endpoints were response rates after induction therapy and the incidence of a need for autologous hematopoietic stem cell transplantion (auto-HSCT) between the groups. We also examined the occurrence of grade 3 or 4 hematological, infection, and thrombotic AEs in both groups.

Results: The VTD group showed an overall response rate (ORR) of 93%, while the VRD group had an ORR of 86%. The very good partial response (VGPR) rates were 61% in the VTD group and 60% in the VRD one. The auto-HSCT rate was higher in the VTD group, averaging 93% compared to 70% in the VRD one. The incidence of grade 3 or 4 hematological AEs was 31% for VTD and 33% for VRD. The rates of grade 3 or 4 infection-related AEs were 9% in the VTD group and 14% in the VRD one. The incidence of grade 3 or 4 thrombotic AEs was 4% for VTD and 3% for VRD.

Conclusions: With comparable safety profiles, VTD and VRD induction therapies are similarly effective for transplant-eligible NDMM, showing similar ORRs and VGPR rates.

Objectives: Chronic myeloid leukemia (CML), a clonal malignant disease arising from the BCR-ABL fusion gene, presents significant therapeutic challenges, particularly in chemotherapy resistance. The role of METTL14, a key m6A methyltransferase, is implicated in cancer biology, but its role in CML remains unclear.

Methods: Peripheral blood mononuclear cells (PBMCs) and CML cell lines (K562 and K562/G01) were conducted in vitro studies. mRNA levels were quantified by quantitative PCR (qPCR), and protein expressions were assessed by Western Blotting. Cell viability and apoptosis were measured using the CCK-8 and flow cytometry, respectively. Drug resistance was evaluated by determining the half-maximal inhibitory concentration (IC50). m6A levels were quantified using liquid chromatography-tandem mass spectrometry (LC-MS/MS), and modification sites were predicted by SRAMP and confirmed with a SELECT detection assay. Gene interactions were validated through luciferase assays.

Results: METTL14 expression was significantly elevated in imatinib-resistant CML patients (P=0.005) and K562/G01 cells (P=0.01), correlating with increased m6A modification levels (P=0.032). Overexpression of METTL14 enhanced m6A methylation, promoted cell proliferation, inhibited apoptosis, and increased imatinib resistance in CML cells. Conversely, METTL14 silencing reduced m6A levels, induced G0/G1 arrest, and enhanced apoptosis (P=0.01). Mechanistically, the luciferase assay results demonstrated that METTL14-mediated m6A modification at the A1001 site of Bcl-x mRNA facilitated HNRNPC-dependent splicing. Consequently, this modification results in shifting Bcl-xS to Bcl-xL and inactivating the BCL-2/BAX/Caspase-3 pathway.

Conclusion: METTL14-driven m6A modification regulates the splicing pattern of Bcl-x, and may facilitate the progression of CML. Keywords: CML, METTL14, N6-methyladenine, Bcl-x, Alternative splicing, resistance, imatinib, progression.

Objective: To summarize the clinical characteristics, treatment outcomes, and prognosis of pregnant patients with hemophagocytic lymphohistiocytosis (HLH), and to evaluate the efficacy of chemotherapy regimens containing etoposide (VP16) in these patients and their impact on survival outcomes.

Methods: A retrospective analysis was performed on 41 pregnant HLH patients admitted to our hospital between April 2015 and March 2024, focusing on clinical features, treatment strategies, and prognostic factors.

Results: Among the 41 cases, 29 developed HLH during pregnancy and 12 postpartum. Etiologies included malignancy-related HLH (5 cases), Epstein-Barr virus (EBV)-related HLH (5 cases), rheumatologic disease-related HLH (2 cases), and pregnancy-related HLH (29 cases, defined as no comorbid HLH-related etiologies except pregnancy). In pregnancy-related HLH patients presenting during gestation, the 2-week overall response rate (ORR) was significantly higher in those receiving VP16-containing induction chemotherapy compared to glucocorticoids-only induction therapy (P = 0.011). Multivariate analysis identified the interval from symptom onset to VP16 initiation as an independent prognostic factor for pregnancy-related HLH (P = 0.025). Survival analysis revealed improved survival in patients who received VP16 within 7 weeks of onset versus those treated after 7 weeks (P = 0.044).

Discussion and conclusion: HLH in pregnancy progresses rapidly. Early administration of VP16-containing chemotherapy significantly improves ORR and survival outcomes, particularly in pregnancy-related HLH.

In this retrospective case-control study involving 424 pediatric patients diagnosed with Pediatric Acute Lymphoblastic Leukemia (ALL), the investigation focused on analyzing the clinical characteristics and prognosis associated with the Cyclin-dependent kinase inhibitor 2A/2B (CDKN2A/2B) gene. Treatment and evaluation followed the South China Children's Leukemia Group-ALL-2016 protocol (SCCLG-ALL-2016). Among the cohort, 92 patients (21.7%) exhibited CDKN2A/2B gene deletions, with 11.1% homozygous and 10.6% heterozygous deletions. Notably, ALL patients that do have CDKN2A/2B gene deletions tended to present at an older age (P = 0.001), demonstrate hepatosplenomegaly on palpation (P < 0.001), and exhibit a higher incidence of Central nervous system leukemia (CNSL) (P = 0.037) and T-ALL (P = 0.007). A significant correlation was observed between ALL that does have CDKN2A/2B gene deletions and ETV6::RUNX1-positive (8.7% vs. 19.3%, P = 0.017) and IKZF1 gene deletions (20.7% vs. 8.4%, P = 0.001). Survival analysis of 392 patients revealed no significant differences in 5-year relapse, Overall survival (OS), or Event-free survival (EFS) between ALL that does/ does not have CDKN2A/2B gene deletions. Subgroup analysis highlighted poorer prognosis among hepatosplenomegaly patients in the CDKN2A/2B gene deletion group, with a 5-year EFS of 81.8%, 95%CI (0.695-0.963), P = 0.05. Hepatosplenomegaly emerged as the most significant prognostic factor for EFS [HR = 2.306, 95%CI (1.192-4.461), P = 0.013]. Cox regression analyses identified covariates influencing prognosis, ALL with the CDKN2A/2B gene showing no significant impact on outcomes. In conclusion, while ALL that does have CDKN2A/2B gene deletions is associated with certain clinical characteristics and genetic aberrations, they did not significantly impact OS or EFS. Furthermore, subgroup analysis revealed a potential prognostic role of ALL that does have CDKN2A/2B deletions presenting with hepatosplenomegaly on palpation, emphasizing the importance of comprehensive risk stratification in treatment decision-making for this subgroup.

Background: Relapsed/Refractory (R/R) diffuse large B-cell lymphoma (DLBCL) represents a subgroup with a high incidence and dismal prognosis. Currently, there is a lack of robust models for predicting R/R DLBCL. Therefore, we conducted a retrospective study to identify key determinants to be incorporated into a novel nomogram to enhance the identification of DLBCL patients at elevated risk of refractoriness/recurrence.

Methods: We included 293 newly-diagnosed DLBCL patients from Harbin Medical University Cancer Hospital, collected from 2008-2017. Patients were randomly divided into a training cohort (n = 206) and a validation cohort (n = 87) at a 7:3 ratio. The training cohort underwent univariable analysis to select variables for a binary logistic regression model. These variables were also prioritized using a random forest algorithm. The developed nomogram was evaluated with the receiver-operator characteristic (ROC) curve, calibration curve, and decision curve analysis (DCA) for its clinical utility.

Results: Univariable analysis pinpointed several factors significantly associated with refractoriness/recurrence, including pathological subtype, lactate dehydrogenase (LDH), International Prognostic Index (IPI), treatment, absolute lymphocyte count (ALC), lymphocyte/monocyte ratio (LMR), and prognostic nutritional index (PNI). Binary logistic regression highlighted pathological subtype, LDH, treatment, and ALC as key predictors, which were incorporated into the nomogram. The nomogram showed excellent calibration and accuracy in both cohorts, and comparative DCA and ROC analysis demonstrated its superior net benefit and area under the curve (AUC) compared to traditional indexes like IPI, R-IPI, and NCCN-IPI.

Conclusion: This nomogram serves as a valuable tool for predicting the likelihood of refractoriness or recurrence in DLBCL patients.

Objective: Liquid-liquid phase separation (LLPS) may affect the therapeutic sensitivity of multiple myeloma (MM). This study aimed to identify LLPS-related genes with MM prognostic values and to confirm their effects on tumor progression.

Methods: Based on public transcriptomic data, this study screened LLPS- and immune-related genes for MM-derived plasma cells. Subtypes were identified using consensus clustering, followed by comparisons using t-test and survival analysis. Least absolute shrinkage and selection operator was implemented to screen prognostic signatures, and Kaplan-Meier and receiver operator characteristic curves were plotted to assess their prognostic values. After transfected with sh-DDX21, CCK8, flow cytometry, and Transwells were used to observe MM cell proliferation, apoptosis, migration, and invasion.

Results: By overlapping LLPS- and immune-related genes, 103 genes were obtained to cluster MM samples into three subtypes, which had significant differences in survival and immune landscape. Cox regression analysis screened out EZH2 and DDX21 that significantly overexpressed in MM to construct a prognostic model, with superior performance in predicting MM prognostic risks. Notably, subtype2 with more adverse prognosis showed significantly elevated risk scores and was more distributed in groups with high prognostic risk. In vitro experiments confirmed that cell proliferation, invasion, and migration were significantly inhibited in MM.1S cells transfected with sh-DDX21.

Conclusion: LLPS-related EZH2 and DDX21 were novel markers to predict prognostic risk of MM. Among them, DDX21 was experimentally confirmed to promote MM cell proliferation, migration and invasion. These potential prognostic markers could be targeted in future personalized therapeutic strategies for MM, potentially improving patient outcomes.