Hematology最新文献

Objectives: Prior research has highlighted immune cells' critical role in multiple myeloma (MM) pathogenesis, yet the causal relationships between them have remained obscure.

Methods: We utilized data from genome-wide association studies (GWAS) of European cohorts to conduct a Mendelian Randomization (MR) analysis, aiming to establish causal links between immune cell phenotypes and MM. We selected single nucleotide polymorphisms (SNPs) associated with immune cell traits at a suggestive significance threshold (P < 1 × 10^-5) to ensure sufficient instrumental variables, with F-statistics (>10) calculated to assess instrument strength. Multiple MR methods were applied to 731 immune phenotypes and MM.

Results: Eight immunophenotypes showed nominal associations with MM risk (P < 0.05). However, no associations survived the strict Bonferroni correction for multiple testing. Suggestive causal effects of MM on immunophenotypic traits are predominantly negative, implying that MM may impair the functionality of immune cells.

Discussion: This study uses GWAS data to elucidate the genetic impact of immune cells on the initiation and progression of MM. It presents genetic evidence suggesting that immune cells could alter MM risk based on a thorough genetic analysis. Bidirectional two-sample MR identified eight distinct immunophenotypes (encompassing four immune signatures: MFI, RC, AC, MP) with causal effects on MM.

Conclusion: Our study provides preliminary evidence for potential causal links between specific immune traits and MM risk. Independent replication in larger cohorts and functional validation are warranted given the nominal significance of these associations, which may inform future immunotherapeutic investigations. These findings contribute to a better understanding of the complex immune - MM interplay and may guide future investigations into immunotherapeutic approaches.

Background: Platelet concentrates play an important role in clinical treatment such as platelet function disorders and thrombocytopenia. In the process of preparation and storage of platelets, centrifugation, leukofiltration, and agitation will cause morphological changes and impaired function of platelets, which is associated with the increase of platelet transfusion refractoriness, and named as platelet storage lesion (PSL).

Method: This paper proposes three major operations (centrifugation, agitation, and leukofiltration) that platelets experience during the preparation and storage process, to explore the effect of physical cues on PSL. The analysis of morphology, metabolism index, and levels of activation markers are used to monitor the quality of stored platelets and definite the role of physical cues in PSL.

Result: In this study, centrifugation, leukofiltration and agitation lead to different degrees of platelet activation, with the extension of storage time. At one hour after separation, PSL can be found through structural change, metabolic parameters, and activation markers of platelets. Agitation maintains more cell numbers, better cell morphology, and lower metabolism rate in platelets, and keeps the low activation state of platelets throughout the storage period. The hard centrifugation group showed the highest level of CD62P expression throughout the storage.

Conclusion: our results indicate that agitation can mitigate PSL by supplying sufficient O₂ during preservation, shear stress may cause PSL immediately after the physical cues were applied; however, hydrostatic pressure induced by filtration is negligible for its effects on PSL. Meanwhile, when the physical cues are big enough, the activation of platelets is irreversible, such as spin at 2000 g. The granule secretion of platelets is a kind of irreversible activation; however, the membrane reorganization of platelets is a kind of reversible activation.

Background: Iron deficiency anemia (IDA) is the most common cause of anemia worldwide. Patients with IDA often present thrombocytosis, but little is known about its degree and prevalence, and its response to iron replacement.

Methods: We conducted a retrospective review of 76 consecutive patients with anemia secondary only to iron deficiency. Laboratory data were collected both at baseline and at 3 months after either oral or intravenous iron replacement therapy. We defined thrombocytosis as a platelet count >400 × 10⁹/L.

Results: The median age of the patients was 54 years (range, 22-90 years), and 59 of 76 (78%) patients were females. The replacement therapy consisted of oral iron (n = 13), intravenous iron (n = 33), or both (n = 30). The median Hb and ferritin levels at baseline and at 3 months after the iron replacement were 9.9 g/dL and 18 mg/dL, and 12.4 g/dL (p < 0.0001) and 113 mg/dL (p < 0.0001), respectively. Thrombocytosis before and after the iron administration was present in 17 (22%) and 4 (5%) patients, respectively. Regardless of thrombocytosis, the platelet count decreased in 55 (72%) patients. The median platelet level at baseline and at 3 months after the iron replacement was 299 (95% CI, 276-330) and 265 (95% CI, 245-295) × 10⁹/L (p < 0.0001), respectively.

Conclusion: Thrombocytosis is found in about one fifth of patients with IDA at baseline, and it is expected to resolve within 3 months of iron replacement therapy in most of them. Iron administration is associated with a decrease of the platelet counts, even in the absence of preexisting thrombocytosis.

Background: While there has been no direct head-to-head comparison, it is assumed that second-line treatment with dasatinib and nilotinib has comparable efficacy but distinct safety profiles in the treatment of patients with chronic phase chronic myeloid leukemia (CML-CP). Our aim was to conduct a real-world analysis to compare the efficacy and safety profiles of these two agents.

Methods: Data from 73 CML-CP patients, who received either dasatinib or nilotinib in second-line treatment, were analyzed. The primary interest of the efficacy assessment was a major molecular response (MMR) at the 12-month, 5-year cumulative incidence of treatment failure, and overall survival.

Results: A total of 73.5% of 34 patients in the dasatinib and 76.9% of 39 patients in the nilotinib group achieved MMR at 12 months. Five-year cumulative probability of treatment failure in patients, who previously achieved MMR was 0 and 7.6% for patients receiving dasatinib and nilotinib, respectively (p = 0.25). Eight-year OS was 82.7 and 86.3% for dasatinib and nilotinib groups, respectively (p = 0.90). Pleural effusions were more common in the dasatinib group, leading to treatment discontinuation, while cardiovascular events and thrombotic incidents were more prevalent in the nilotinib group.

Conclusion: Dasatinib and nilotinib exhibit similar efficacy in the CML-CP treatment. Individualized patient management should consider patient comorbidities and safety profiles.

Background: The health implications of trace elements have become increasingly concerning, yet the connection between blood manganese levels and anemia remains insufficiently examined. This research endeavors to explore the potential linkage between blood manganese concentrations and anemia.

Methods: Utilizing data from the National Health and Nutrition Examination Survey (NHANES) from 2011 to 2018, this study examines the correlation between blood manganese levels and anemia among U.S. adults, offering a comprehensive national perspective. The study included 11,300 adults aged 20 and above, with both blood manganese and hemoglobin levels measured. Generalized Additive Model (GAM) was applied to delineate smooth curves, and threshold effect analysis was performed to identify the inflection points of these curves. Subsequently, unconditional logistic regression was employed to assess the risk.

Results: Our research involved a total of 11,300 individuals, among which 1,143 (10.1%) were identified with anemia. The curve fitting analysis indicated a U-shaped relationship between blood manganese levels and the risk of anemia. Specifically, when blood manganese levels were below 8.69 µg/L, increasing concentrations were linked to a decreased risk of anemia, with an adjusted OR of 0.838 (95% CI: 0.735-0.954), indicating a protective effect of this level of blood manganese against anemia. Conversely, when blood manganese levels were at or above 8.69 µg/L, further elevations were strongly associated with an increased risk of anemia, with the adjusted OR rising to 1.160 (95% CI: 1.124-1.196), suggesting that excessively high blood manganese levels significantly raised the risk of developing anemia.

Conclusion: This study provides novel insights into the association between blood manganese levels and anemia. Further extensive, population-based cohort studies are necessary to validate the causality and to uncover the intrinsic toxicological mechanisms.

Background: This study investigates the expression and clinical significance of the histamine receptor family (HRs) in the bone marrow of children with newly diagnosed acute myeloid leukemia (AML).

Methods: RNA sequencing was performed to assess the expression levels of HR family members (HRH1, HRH2, HRH3, and HRH4) in the bone marrow of 140 pediatric AML patients prior to chemotherapy. We compared the expression levels across various risk categories and assessed their relationship with prognosis using ROC curve analysis to evaluate predictive capabilities for outcomes.

Results: Among the 140 AML patients in our center, those with different FAB subtypes showed varying overall survival (OS), event-free survival (EFS), and relapse-free survival (RFS). Specifically, the M2 and M4 subtypes showed better OS, EFS, and RFS, whereas the M5 subtype had poorer outcomes. Among patients with different fusion genes, those with AML1/ETO had superior OS, EFS, and RFS compared to other subtypes. Additionally, patients with CEBPA mutations demonstrated relatively favorable outcomes, whereas those with FLT3 mutations had poorer survival metrics. HRH1 expression was significantly higher in AML patients than in normal controls (P < 0.05). Patients in the high HRH1 expression group had significantly better EFS and RFS than those in the low expression group (P < 0.05). Furthermore, HRH1 expression was significantly higher in the low-risk (LR) group than in the intermediate and high-risk (IR & HR) groups (P < 0.05). This finding suggests that HRH1 may serve as an early predictor of risk, EFS, and RFS.

Conclusion: The clinical significance of HR family members varies in pediatric AML, with HRH1 identified as a valuable predictor of relapse in children with AML.

Objective: Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

Methods: The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

Results: The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

Conclusions: We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

Allogeneic hematopoietic stem cell transplantation (Allo-HSCT) remains the mainstay of treatment for adults with high-risk acute lymphoblastic leukemia (ALL). Due to the crucial role of measurable residual disease (MRD) before Allo-HSCT in predicting relapse and the promising anti-leukemia effect of blinatumomab, we documented a short-course, low-dose conditioning regimen incorporating blinatumomab for Allo-HSCT in three ALL patients with positive MRD. Following the administration of the blinatumomab-containing conditioning regimen, all patients attained complete remission (CR) with negative MRD status, and no severe adverse events were observed. After a 2-year follow-up, 2/3 of patients remained disease-free and attained long-term survival following transplantation. These cases indicated a short-term blinatumomab conditioning regimen may effectively prolong patient survival, improve prognosis, and offer a safe and cost-effective treatment for high-risk ALL patients with positive MRD. The addition of blinatumomab to the conditioning regimen of Allo-HSCT is feasible for high-risk ALL patients with positive MRD.

Objectives: Controlling Nutritional Status (CONUT) Score is an effective tool for the assessment of malnutrition and proved to be associated with survival of Diffuse large B-cell lymphoma (DLBCL) patients. We investigated the impact of CONUT score on specific subgroups of DLBCL patients, including age and International prognostic Index (IPI) risk groups.

Methods: Data of 287 newly diagnosed DLBCL in the Third Affiliated Hospital of Soochow University were retrospectively collected. Baseline CONUT score, clinical data and survival information were recorded.

Results: With the standard cut-off value of 4 points, 88 (30.7%) patients were clarified as malnourished. During a median follow-up of 34 months, malnourished patients exhibited significant reduction in both progression-free survival (PFS) and overall survival (OS). The 3-year PFS rates for malnourished and well-nourished patients were 51.4% and 70.9% (p = 0.001), while the 3-year OS rates were 62.4% and 84.0% (p < 0.001). Malnutrition was demonstrated an independent predictor of OS in DLBCL patients (HR 2.220, 95% CI 1.307-3.772, p = 0.003). It could effectively identify patients with inferior OS in both low/intermediate-low risk and intermediate-high/high risk IPI groups. In the group of elderly patients aged over 60 years, malnutrition was independently associated with OS (HR 2.182, 95% CI 1.178-4.040, p = 0.024), but not PFS (HR 1.709, 95% CI 1.016-2.875, p = 0.070) after adjustment using the Benjamini-Hochberg procedure. Conversely, for younger patients, malnutrition did not demonstrate an independent impact on either PFS or OS.

Conclusion: Malnutrition evaluated by CONUT score was an independent predictor for the outcome of DLBCL patients, which is exclusively caused by its effect on elderly patients.

Purpose: This study was designed to investigate the relationship between peripheral blood inflammatory markers and prognosis in MDS patients.

Methods: We conducted a study involving 183 MDS patients who were diagnosed at Taizhou Hospital of Zhejiang Province and Enze Hospital between January 2015 and December 2019. The end point of follow-up was September 2022. To minimize the impact of other confounding factors among the 110 included MDS patients, X-tile software was used to determine the optimal cutoff points for peripheral blood inflammation markers. Based on these cutoff points, the cohort of patients was divided into a high-risk group and a low-risk group. The OS in each group was analyzed by the Kaplan-Meier method, and univariate and multivariate Cox regression analyses were employed.

Results: The MDS patients included 73 men and 37 women with a median age of 72 years (32-92 years). The median OS was 28 months (1-83 months), 17 patients (15.45%) experienced conversion to AML, and 94 patients (85.45%) died during the follow-up period. The optimal cutoff points were ALC (1.2 × 10⁹/L), AMC (0 × 10⁹/L), CRP (6.1 mg/L), MLR (0.125), NLR (2.25) and PLR (71.4). Patients in the ALC (≤1.2 × 10⁹/L, P = 0.017), MLR (>0.125, P = 0.01), PLR (>71.43, P = 0.044), and CRP (>6.1 mg/L, P < 0.0001) groups had shorter overall survival. The MLR (>0.125, P = 0.011) and CRP (>6.1 mg/L, P = 0.017) levels were related to poor prognosis.

Conclusions: Elevated MLR and CRP levels may be independent indicators of poor prognosis in newly diagnosed MDS patients.