Plant Cell Reports最新文献

Protein transport is a tightly regulated and complex cellular process fundamental to growth and development. A critical aspect of this process is the accurate and timely translocation of transcription factors and other components of the transcriptional machinery into the nucleus, which is indispensable for the regulation of gene expression. Calmodulin (CaM), a conserved calcium-sensing protein, binds 4 calcium ions and, upon activation, triggers a cascade of signaling events that fine-tune transcriptional outcomes. Notably, CaM exerts a dual regulatory role-facilitating or inhibiting the nuclear import of proteins depending on the cellular context. This review provides a detailed account of the structure and function of CaM, elucidates the molecular basis of its interactions with nuclear transport components, and presents case studies that substantiate its role as a modulator of nuclear protein trafficking across diverse organisms, including recent findings in plants. In addition, we have summarized the potential future applications and implications of CaM-mediated nuclear transport. This finding paves the way for further exploration of how calcium-signaling and CaM-mediated protein transport shape plant development and stress responses. Beyond elucidating the complex regulation of protein localization in plant cells, this insight may also offer new strategies for enhancing plant growth, development, and resilience under stress conditions.

Key message: Embryo abortion occurred at 20 DAP of HFS × RM, with trans-Zeatin-riboside and brassinolide playing key roles during embryo abortion. Rhododendron is a world-famous flower with high ornamental and economic value. However, hybridization between the Rhododendron subgenus Tsutsusi and subgenus Pentanthera is often hindered by reproductive barriers, which restrict breeding of new cultivars. To determine the reproductive barriers between these two subgenera, artificial crosses were conducted using three cultivars in subgenus Tsutsusi (R. × 'Tiehong' (TH), R. × 'Hongfushi' (HFS) and R. × 'Hongyue' (HY), as the maternal parents), and the wild species R. molle (RM) in subgenus Pentanthera as the paternal parent. The results showed that the pollen tube stopped growing at 1/3 of the style of HY at 72 HAP, indicating a pre-fertilization barrier in HY × RM. The seeds of TH × RM were obtained at 230 DAP, indicating no reproductive barriers. In contrast, HFS × RM embryos developed only globular embryos by 10 DAP and aborted by 20 DAP, indicating a post-fertilization barrier. Hormone-targeted metabolomics determined 21 kinds of plant hormones in the ovaries of TH × RM and HFS × RM. Among them, the contents of trans-Zeatin-riboside (tZr) in TH × RM remained stable from 10 to 20 DAPs; however, in HFS × RM, it decreased significantly by 65% during this stage. Furthermore, Brassinolide (BR) was only detected in the ovaries of HFS × RM at 20 DAP. The results indicated that tZr and BR are likely to be the important hormones responsible for the embryo's abortion, which can aid in breeding of distant hybridization in Rhododendron by adopting suitable strategies to overcome the barriers.

Key message: Scalable moss bioreactors enable the production of high-quality recombinant prolyl-hydroxylated human collagen without heterologous P4H expression, offering a sustainable and vegan alternative to conventional collagens derived from animals. Collagens are structural proteins of the extracellular matrix essential for skin elasticity and integrity. They are widely used in dietary supplements and cosmetics. Conventional collagens of animal origin raise concerns regarding ethics, safety, and sustainability. As a vegan alternative, we report on the production of a 30 kDa prolyl-hydroxylated human collagen polypeptide from Physcomitrella moss plants. For secretion-based production and formulation compatibility, a hydrophilic region encompassing 334 amino acids from human type III collagen was selected, which includes four protein domains involved in cell adhesion, collagen binding, integrin recognition and wound healing. Transgenic moss lines were generated via protoplast transformation. Immunodetection identified collagen-producing lines, and mass spectrometry validated the product and detected prolyl-hydroxylation on 23 sites. The presence of this important post-translational modification underscores the high biomimetic quality of the product. To enable industrial-scale production, the transformants were quantitatively analysed at the genomic, transcript, and protein levels. The most productive lines were forwarded to process development, where culture conditions, including CO₂ supplementation, pH, and light intensity, were optimized. Upscaling to 5 L photobioreactors established a robust, light- and biomass-dependent production regime that yielded nearly 1 mg/L of secreted collagen polypeptide in the culture supernatant after 11 days of cultivation. Taken together, this study presents the first scalable moss-based production of a post-translationally modified human collagen and offers a sustainable and vegan alternative to conventional collagens for cosmetic formulations. This highlights the versatility of Physcomitrella as a production host for high-quality proteins with industrial applicability that also meet consumer requirements.

Key message: Mapping of an early bolting mutant and functional verification of its causal gene revealed that BrTFL2 was associated with bolting in Chinese cabbage. Early bolting is a breeding target trait of Chinese cabbage for stalk-type cultivars. In this study, we characterized an early bolting mutant in Chinese cabbage, ebm13, which bolted earlier than its WT under both LD and SD conditions. Genetic analysis indicated that the mutant phenotype was controlled by a monogenic recessive nuclear gene. Using MutMap combined with KASP genotyping, we identified a candidate SNP (SNP15757783) in BrTFL2, a key gene regulating the meristem's response to light signals. BrTFL2 was functionally validated through VIGS and ectopic overexpression in Arabidopsis thaliana. In ebm13, SNP15757783 was located at the junction of the 6th intron and the 7th exon, disrupting the 3' splice site from AG to AA and thereby leading to an obstacle to proper RNA splicing, while CDS sequence analysis displayed that the 7th exon had a loss of twenty-one bases (CTGATTGAATTCTACGAGCAG). BrTFL2 was localized in the nucleus. Compared with the WT, the ebm13 mutant exhibited reduced H3K27me3 enrichment in the promoter regions (P1 and P2) of BrFTa/b and elevated expression levels of BrFTa/b.

Key message: CaWRKY6 functions together with CaERF3 to regulate ROS production, thus positively modulating pepper salt stress response. Salt stress significantly inhibits the growth and productivity of plants. Pepper (Capsicum annuum L.), a widely cultivated economic horticultural crop, exhibits high sensitivity to salinity. This study investigates the role of the transcription factor CaWRKY6 in modulating pepper's responses to salt stress. Our findings indicate that CaWRKY6 predominantly localizes at the cell nucleus, and its expression is significantly induced upon salt treatment. The CaWRKY6-silenced pepper plants exhibit heightened sensitivity to salt stress, as evidenced by increased malondialdehyde (MDA) levels and decreased proline content. Additionally, CaWRKY6-silenced pepper plants show elevated levels of reactive oxygen species (ROS). Through a yeast two-hybrid screen, CaERF3 is identified as an interactor of CaWRKY6. Silencing CaERF3 expression induces a similar sensitive salt response and elevated ROS levels as observed in CaWRKY6-silenced plants. Collectively, our results demonstrate that the CaWRKY6-CaERF3 module positively regulates salt stress responses in pepper by modulating ROS homeostasis.

Key message: The DOF transcription factors regulating plant bud dormancy were novelly identified. A representative member, PlOBP4, was first experimentally verified to promote bud elongation. Herbaceous peony (Paeonia lactiflora) is a world-renowned ornamental flower mainly cultivated in temperate regions. However, insufficient winter chilling accumulation may limit bud endodormancy release (BER) due to climate change or when grown at lower latitudes or elevations. Understanding the regulatory mechanisms of endodormancy release will help develop new cultivars adapted to warm winter conditions, advancing the application of herbaceous peony in subtropical and even tropical areas. The role of DNA-BINDING WITH ONE FINGER (DOF) TF family members in the regulation of bud dormancy remains limited. In this study, a bioinformatics analysis of the DOF family in P. lactiflora 'Hang Baishao' (a subtropical low-chilling-requirement cultivar) was performed using the full-length transcriptome sequencing data collected during a whole winter and early spring. A total of 15 DOF family members were identified and were phylogenetically classified into four subgroups. Expression profiles of some PlDOFs were correlated with bud endodormancy acquisition, BER, release of ecodormancy, and inducing break. A PlOBP4 with a 906 bp coding sequence, which is highly expressed in the BER stage, was identified and cloned. Subcellular localization confirmed that PlOBP4 was nuclear-localized. Silencing PlOBP4 in buds during the endodormancy induction period significantly reduced bud length after sprouting, indicating that PlOBP4 may promote bud elongation in P. lactiflora 'Hang Baishao'. This relatively rare study in regulating bud dormancy/budbreak enriches the knowledge regarding the role of DOF TFs and may further aid in breeding cultivars with short endodormancy duration (low chilling requirement) and facilitate the cultivation of herbaceous peony in subtropical or even tropical regions.

Key message: We identified the characteristics of CBL and CIPK families of Magnolia biondii and the MbCBL4-overexpressed Arabidopsis plants conferred salt tolerance. Calcineurin B-like protein (CBLs) and CBL-interacting protein kinase (CIPKs) are important components of the Ca²⁺-mediated signal pathway. These proteins play a key role in plant growth, development, and response to environmental stress. Magnolia biondii is a woody plant valued for ornamental and medicinal uses and is frequently exposed to abiotic stresses during its growth cycle. Nevertheless, there are still gaps in the study of CBL and CIPK gene families in M. biondii. In this study, 6 CBL and 20 CIPK genes were identified from the M. biondii genome. Phylogenetic analysis divided these genes into 4 CBL and 7 CIPK subgroups, and cross-species comparisons across 34 plants indicated that monocotyledons generally harbor more CBLs/CIPKs than Magnoliaceae. Quantitative real-time PCR (qRT-PCR) analysis revealed that MbCBLs and MbCIPKs showed different transcription levels under drought, cold, and salt stress. Protein-protein interaction assays (Y2H and LCI) verified physical interaction of MbCBL1/MbCIPK18 and MbCBL4/MbCIPK18. Functionally, MbCBL4 overexpression in Arabidopsis conferred enhanced salt tolerance: primary root length and chlorophyll content increased by 2.74-fold and 2.71-fold relative to wild type; fresh weight increased by up to 60%, SOD and CAT activities rose by 47% and 28%, while H₂O₂ and O₂⁻ levels declined by 46% and 38%. These results indicate that MbCBL4 enhances salt tolerance by promoting growth, antioxidant capacity, and reactive oxygen species scavenging. These findings provide important insights into the functional roles of MbCBL and MbCIPK genes and the regulation of MbCBL4 under salt stress.

Auxin, a plant growth regulator responsive to environmental stresses like drought, plays a crucial role in signaling, gene regulation, and plant sustainability. Drought sensitivity is linked to auxin-mediated cellular interactions, and gaining insights at genomic, cellular, and physiological levels can enhance plant resilience. This review discusses drought stress impacts and auxin sensitivity in cellular and nuclear modules. The biosynthetic and catabolic routes of auxin influence influx and metabolic reprogramming at both cellular and subcellular levels. Auxin interaction with other hormones affects rhizosphere sensitivity and systematic plant signaling. Subcellular drought tolerance is maintained by metabolizing reactive oxygen species, ensuring redox homeostasis. The review also covers transcriptomes regulated by auxin-responsive factors and miRNAs that modulate selective transcripts under drought. It emphasizes epigenetic regulation, including methylation, histone modification, and chromatin remodeling. Specific nucleotide residues and their auxin-induced modifications may help recall stress memory to better combat drought. For sustainable development under drought, strategies involving specific rhizobacteria and nanomaterials are discussed. New perspectives on genome stability, particularly with CRISPR/Cas9 for editing auxin-sensitive genes, aim to improve drought tolerance in crop varieties and selectable traits. Conclusively, the present review highlights auxin's imperative role in plant reprogramming under osmotic stress, making it a key candidate for eco-friendly crop production to ensure food security.

Key message: This study demonstrates the critical role of OsRAD51A1 in maintaining meiotic stability in tetraploid rice, which can improve the seed-setting rate and promote the development of polyploid rice. Polyploid rice has a range of significant advantages over diploid rice. However, low seed-setting rates seriously limited development of polyploid rice for several decades until polyploid meiosis stability (PMeS) lines with high seed-setting rate were bred. Three meiotic genes were identified as candidates associated with stable meiosis and high seed-setting rate in PMeS lines. The function of one candidate gene, OsRAD51A1, in tetraploid rice was investigated in this study. Throughout the whole young panicle development period, OsRAD51A1 expression level in PMeS line A1-4x was higher than that in non-PMeS line NG46-4x, with A1-4x showing peak expression at meiosis stage; meanwhile, the methylation level of promoter CpG island in NG46-4x was consistently higher than that in A1-4x. The OsRAD51A1 was localized to nucleus. Following RNAi-mediated silencing of OsRAD51A1 in PMeS line A1-4x, chromosomal behavior during meiosis became disordered, pollen development was abnormal, pollen malformation rate increased, ratios of fertile and viable pollen decreased significantly, and seed-setting rate was significantly reduced. Conversely, OsRAD51A1 overexpression in non-PMeS line NG46-4x effectively normalized chromosomal behavior during meiosis and pollen development, morphology, fertility, and viability, and seed-setting rate increased significantly. It is inferred that loss of OsRAD51A1 leads to an increased number of univalents and multivalents during prophase I in tetraploid rice, further affecting development and fertility of gametes, and resulting in decreased seed-setting rate. OsRAD51A1 may play a pivotal role in the process of homologous chromosome pairing, recombination, and ultimately affects the tetraploid rice seed-setting rate.

Key message: PmVNS2 promotes secondary cell wall formation and enhances xylem development in transgenic poplar. Secondary cell wall deposition is essential for wood formation in trees, and NAC-domain transcription factors are widely involved in transcriptional networks associated with this process. Here, we identified PmVNS2, a VND-subfamily NAC gene from Pinus massoniana. PmVNS2 encodes a conserved NAC-domain protein and shows preferential expression in developing xylem. Heterologous expression of PmVNS2 in Populus davidiana × P. bolleana resulted in enhanced plant growth and secondary xylem development, accompanied by increased secondary cell wall thickening. Molecular analyses showed that PmVNS2 overexpression was associated with altered expression of genes related to lignin and cellulose biosynthesis. In addition, several downstream transcriptional regulators involved in secondary wall formation were affected, while some hemicellulose-related genes exhibited reduced expression. Together, these findings suggest that PmVNS2 may participate in transcriptional regulation associated with secondary cell wall formation and contribute to wood development-related processes in conifer species.