Open Veterinary Journal最新文献

Background: Colibacillosis caused by Escherichia coli causes significant economic losses in the livestock sector worldwide and is one of the calves' leading causes of diarrhea.

Aim: This study aimed to identify the most frequent E. coli molecularly pathotypes in calves with diarrhea in six provinces of the Cajamarca region in the northern highlands of Peru.

Methods: Twenty-eight herds of dairy cattle under a semi-intensive rearing system were evaluated; 95 samples were isolated from calves with diarrhea up to the first month of life, 62 males and 33 females, during the rainy season.

Results: The presence of virulence genes of E. coli strains was more prevalent in males; the astA (89.47%), st (83.15%), and f5 (57.89%) genes were more expressed, and the lt (17.89%) and stx2 (1.05%) genes were less expressed. The eae gene (21.05%) was more present in females.

Conclusion: When E. coli strains express virulence genes astA, st, and f5 and their atypical double, triple, and quadruple combination between different observed pathotypes, they give rise to the formation of several pathotypes by the horizontal transfer of virulence genes, which can cause colibacillosis processes in more virulent calves, which is one of the most important causes of diarrhea in calves in the region of Cajamarca, compromising the sanitary viability in the herds.

Background: Alpacas have reproductive traits such as induced ovulation and a higher gestation rate in the left uterine horn (LUH). Additionally, low fertility and high embryonic mortality are significant challenges in alpaca breeding. To address these issues, it is essential to study the histological changes occurring in the uterine wall during day 8 of the luteal phase (LP).

Aim: This research aims to describe these changes in alpacas with induced ovulation using GnRH or copulation.

Methods: The study was conducted on 8 sexually mature fertile alpacas with a preovulatory follicle of ≥ 7 mm. Ovulation was induced with GnRH (G1, n = 3) and natural mating' (G2, n = 5), confirmed by ultrasound showing the disappearance of the follicle and formation of the corpus luteum (CL). On day 8 of the LP, samples of the uterine wall from the right and LUHs were obtained through a midline laparotomy. A uterine lavage with PBS was also performed, and no embryo-ova was found. The tissues were fixed, processed, and stained with Hematoxylin and Eosin. Measurements of the myometrium and endometrium, the area of the superficial and deep endometrial glands, the height of the gland cells, and the height of the endometrial mucosal cells were performed using microscopy and software. The measurements were taken in microns (um), from 12 different photographs per animal.

Results: In G2 (copulation), greater thickness of the endometrium and myometrium, as well as a larger area of the superficial glands and cell height, were observed (p < 0.005). Additionally, the area of the superficial glands in the left horn was greater compared to the right.

Conclusion: The thickness of the myometrium and endometrium, and the area of the superficial glands of the LUH in alpacas during the LP (day 8), induced by copulation (G2), show better development. This research provides new insights into changes in the histomorphometry of the alpacas' uterus during this stage and is the first report on this species.

Background: The calabash (Crescentia cujete L.) is a tropical fruit that offers numerous health benefits. Its fermented calabash (FC) has been found to affect the neurological system positively. However, its impact on hematology, clinical chemistry, and CD4+ and CD8+ levels has yet to be documented.

Aim: Therefore, this study aims to examine the effects of FC on hematology, clinical chemistry, and the levels of CD4+ and CD8+ in the circulatory system using rat models.

Methods: This study used twenty male Sprague Dawley rats. The rats were divided into group 1 (0 mg/kg BW FC), group 2 (50 mg/kg BW FC), group 3 (500 mg/kg BW FC), and group 4 (2,000 mg/kg BW FC). The treatment was administered using a gastric probe once daily for 14 days. On day 15, the blood samples were collected and tested against hematology, clinical chemistry, quality of the erythrocytes, and CD4+/CD8+. The data were then analysed using SPSS with p-value at 0.05.

Results: The conducted study demonstrated that the utilization of FC at varying doses did not have a significant impact on the hematological profile changes (p ≥ 0.05), except for total lymphocytes and a decrease in the neutrophils/lymphocytes (N/L) ratio (p ≤ 0.05). Furthermore, FC did not influence the changes in clinical chemistry, circulatory protein, and electrolyte levels in rat models compared to the control (p ≥ 0.05). The utilization of FC decreased the percentage of hemolysis and elevated the adenosine triphosphate (ATP) concentration (p ≤ 0.05). Additionally, the use of FC led to a significant increase in CD4+ and the ratio of CD4+/CD8+ (p ≤ 0.05), while no significant effect was observed regarding CD8+ (p ≥ 0.05).

Conclusion: The study highlighted FC's beneficial effects on the haemorheology and immune system, specifically on the decrease in the percentage of hemolysis, elevated ATP concentration, number of lymphocytes, ratio N/L, CD4+, and the CD4+/CD8+ ratio, without causing significant changes to the hematological and clinical chemistry profiles in rat models.

Background: The fungus comb is a unique structure inside termites' nests that facilitates the growth of Termitomyces sp. as a nutrient source for the termites. It is known to possess immunomodulatory properties that boost the immune system.

Aim: The objective of this study was to assess the impact of ethyl acetate extract of fungus comb (EAEFC) on the inflammatory reaction in the spleen of mice induced by intraperitoneal injection of lipopolysaccharide (LPS).

Methods: An experimental study was conducted using a post-test-only control group design with male BALB/C mice (n = 24). The mice were divided randomly into four groups, each comprising six mice, and administered substances via gavage. Groups I and III were administered a solution of 5% dimethyl sulfoxide (DMSO) in distilled water, while Groups II and IV were given 500 mg/kg BW EAEFC dissolved in 5% DMSO. On the fifteenth day, Groups I and II received intraperitoneal injections of 5 ml/kg BW saline, while Groups III and IV were injected with 10 mg/kg BW LPS dissolved in saline. After three hours, the mice were euthanized and splenic immunohistology was examined under a light microscope. The results were expressed as mean ± standard deviation, while the group differences were assessed statistically.

Results: The expression of interleukin (IL)-1, furin, and activated NK cell was significantly higher in the inflamed model after EAEFC supplementation, while the extract suppressed IL-10.

Conclusion: EAEFC was found to alter cytokine expression in the spleen in response to inflammation.

Background: Infertility is defined as failure to achieve a pregnancy after 12 months or more of regular unprotected sexual intercourse. The prevalence of couples with infertility increases every year. Treatment success for male infertility remains suboptimal despite the advancements of the therapies. Hence, a comprehensive understanding of spermatogenesis is needed to improve existing infertility treatments. Animal models are commonly used in studies regarding male infertility. Aluminum chloride (AlCl₃) has been established as an infertility-inducing agent.

Aim: This study investigates the optimal dosage of AlCl₃ in infertility mice models.

Method: Male Balb/c mice, aged 3 months and have proven to be fertile with an average body weight of 26, 96, randomly assigned to four groups. The control group received oral gavage with sterile aquadest, while the treatment groups were administrated AlCl₃ at doses of 100, 150, and 200 mg/kg BW orally over a 53-day period. Assessment of the sperm motility, concentration, morphology, viability, hormone levels, and testicular histopathology were included in this study.

Results: Administration of AlCl₃ did not significantly affect body weight, testicular weight, and hormone levels. However, semen analysis showed a reduction in seminal parameters among treatment groups, supported by testicular histopathology.

Conclusion: Utilizing AlCl₃ to induce infertility in mice models is not quite effective and displayed variable efficacy across different dosages. Further investigations are needed to elucidate optimal dosage, route of administration, and timing to establish reliable mice infertility models.

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

Aim: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3^oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R ²) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

Background: Pseudomonas aeruginosa is a highly antimicrobial-resistant pathogen with a very narrow range of effective antibacterial agents. Therefore, finding alternative compounds is highly required, such as silver nanoparticles (AgNPs).

Aim: The current study was conducted to identify the multidrug resistance (MDR) profile and perform a phylogenetic analysis on P. aeruginosa isolates recovered from clinical samples (human, cows, cats, and fish) and to study their susceptibility to AgNPs.

Methods: 40 samples were subjected to conventional cultivation and biochemical analyses to identify P. aeruginosa. Moreover, these isolates were tested for their antibiotic resistance profile and their response to AgNPs using disk diffusion methods. PCR and Sanger-based sequencing were performed using the 16S rRNA gene as a target.

Results: The results showed that all isolates were resistant to cefixime and sensitive to meropenem. Conversely, the AgNPs were effective in producing larger zones of inhibition. The PCR revealed amplification of the target, and the sequencing and phylogenetic tree of four isolates revealed close similarity with global human sequences from different regions.

Conclusion: The study reveals the MDR characteristics of P. aeruginosa. The isolates are highly susceptible to silver nanoparticles.

Background: The increase in the intensity of agricultural production is associated with the action of various stress factors on the organism of birds, which can lead to negative consequences. Prevention of the development of stress conditions in farm birds, particularly broiler chickens, in industrial production, is the most important task facing scientists and practitioners.

Aim: The objective of this study was to investigate the effect of a combined probiotic preparation and zinc glycinate on the indicators of immunity, biochemical parameters, and antioxidant status.

Methods: The study was conducted on broilers of Arbor Acres cross: the birds in the negative control group received a balanced feed mixture, a mineral and vitamin premix without zinc; the positive control group treated with an injection of cyclophosphamide and received the balanced feed with the mineral and vitamin premix without zinc; in experimental group I, broilers was treated with the injection of cyclophosphamide and received balanced feed, probiotic and zinc glycinate; in experimental group II, broilers received balanced feed, probiotic and zinc glycinate. At the end of the experiment, some blood from the wing vein was collected for evaluation of hematological and biochemical blood parameters using automatic morphological and biochemical analyzers, evaluation of immune status by enzyme immunoassay, and antioxidant status by colorimetric method.

Results: It was found that the developed strategy nutrition leveled the effects of immunosuppression - there was an increase in the level of lymphocytes, interleukin-4, and interleukin-10; the level of cholesterol, triglycerides, glucose, and total protein (TP) tended to the control values; there was a significant increase in serum interleukin-2 and interferon gamma; increase in TP on the background of triglycerides decreased in broilers of experimental group II. An increase in the activity of superoxide dismutase and catalase against the background of a decrease in the level of malonic dialdehyde was revealed in the experimental groups.

Conclusion: The developed strategy of broiler chicken nutrition can be used for the successful protection of birds from immunodeficiency states, improvement of antioxidant status, and maintenance of complete protein and lipid metabolism.

Background: The initial diagnostic markers are important for general practitioners to identify cats suspected of having cardiac disease, particularly hypertrophic cardiomyopathy (HCM).

Aim: The aim of this study is to investigate the indicators that suggest feline cardiac disease, especially HCM.

Methods: This is a retrospective study, using the data from 354 cats, to identify various clinical parameters that indicate the presence of cardiac disease in cats in order to develop a model to predict the likelihood of HCM in cats. Among all the parameters gathered, heart sound and LA size are the most significant in predicting the likelihood of HCM in cats.

Results: After undergoing statistical analysis, we created a formula that could help screen cats with HCM and normal cats before further diagnosis, such as echocardiography. The formula Y₁ = -3.637 +2.448 (LA size) +2.683 (murmur) +1.274 (gallop) is the fittest model with an area under curve from the ROC analysis of 0.889. A new set of data was used to validate the model. This predictive model has 40% accuracy but correctly predicts 90% of the truly normal cats, making this model beneficial in helping veterinarians exclude truly normal cats from cats suspected of having HCM.

Conclusion: The model may assist in distinguishing normal cats from those suspected of having HCM. Further diagnosis with echocardiography remains the gold standard for the final diagnosis of cardiac diseases in cats.

Background: After the first Avian Influenza H5N1 outbreak in Nigerian poultry in 2006, subsequent waves of outbreaks occurred, causing substantial losses. Despite effective control measures by 2008, a resurgence in 2015 led to further losses and required depopulation efforts.

Aim: The aim of this study was to do pathology and molecular detection of influenza A subtype H9N2 virus in commercial poultry in Nigeria during 2024.

Methods: In February 2024, a poultry farmer reported high mortality in his mixed commercial poultry flock in Ibadan, Nigeria, submitting carcasses to the University of Ibadan's V.T.H. and the FAO Regional Laboratory at National Veterinary Research Institute (NVRI), Vom.

Results: Necropsy of nine Isa Brown layers and three Abor Acre broilers revealed cyanosis of comb and wattles, generalized petechial and ecchymotic hemorrhages including shank hemorrhages with sinusitis, pneumonia, and severe greenish fecal pasting also observed. At histopathology, denudation of the tracheal epithelia and parabronchial epithelial necrosis, obliteration, with airsac edema and emphysema were observed. At NVRI, qPCR detected an Influenza A H9N2 virus in several pooled organ samples of layers, and broilers and eliminating the avian infectious bronchitis and Newcastle disease viruses.

Conclusion: This is the first report of an H9N2 outbreak in commercial poultry in Southern Nigeria. The high pathogenicity shown in commercial poultry in this outbreak and the risk of dispersal of infected live poultry in Nigeria as previously seen in H5N1 require stakeholders' intervention.