Plant, Cell & Environment最新文献

As the single link between leaves and the rest of the plant, petioles must develop conductive tissues according to the water influx and sugar outflow of the leaf lamina. A scaling relationship between leaf area and anatomical traits of xylem and phloem is expected to improve the efficiency of these tissues. However, the different constraints compromising the functionality of both tissues (e.g., risk of cavitation) must not be disregarded. Additionally, deciduous and evergreen plants may have different strategies to produce and package their petiole conduits to cope with environmental restrictions. We explored in 33 oak species the relationships between petiole anatomical traits, leaf area, stomatal conductance, and photosynthesis rate. Results showed allometric scaling between anatomical structure of xylem and phloem with leaf area. We also found correlations between photosynthesis rate, stomatal conductance, and anatomical traits in the petiole. The main novelty is how oaks present a different strategy depending on the leaf habit. Deciduous species tend to increase their diameters to achieve greater leaf-specific conductivity. By contrast, evergreen oaks develop larger xylem conductive areas for a given leaf area than deciduous ones. This trade-off between safety-efficiency in petioles has never been attributed to the leaf habit of the species.

The increasing contamination of agricultural soils with cadmium (Cd) poses a significant threat to human health and global food security. Plants initiate a series of mechanisms to reduce Cd toxicity. However, the response of maize to Cd toxicity remains poorly understood. In this study, we identified that ZmHMT3, which encodes a homocysteine S-methyltransferases family protein, acted as a regulator of Cd tolerance in maize. Subcellular localization and in situ PCR exhibited that ZmHMT3 was localized in the cytoplasm and predominantly expressed in the phloem. Overexpression of ZmHMT3 enhanced Cd tolerance and reduced Cd concentration in both shoots and roots. In contrast, ZmHMT3 mutants attenuated Cd tolerance but did not change shoot Cd concentration. Heterologous overexpression of ZmHMT3 in rice enhanced Cd tolerance and reduced grain Cd concentration. Transcriptome analysis revealed that ZmHMT3 upregulated the expression of stress-responsive genes, especially glutathione S-transferases (GSTs) and transcription factors, including MYBs, NACs and WRKYs, and modulates the expression of different ATP-binding cassette (ABC) transporters, thereby enhancing Cd tolerance. Collectively, these findings highlight the pivotal role of ZmHMT3 in Cd tolerance and as a candidate gene for improving Cd tolerance in elite maize varieties.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Legumes, characterized by their ability to form symbiotic relationships with nitrogen-fixing bacteria, play crucial roles in agriculture, ecology and human nutrition. Phosphatidylethanolamine-binding proteins (PEBPs) are the key genetic players that contribute to the diverse biological functions of legumes. In this review, we summarize the current understanding of important roles of PEBP genes in legumes, including flowering, inflorescence architecture, seed development and nodulation. We also delve into PEBP regulatory mechanisms and effects on plant growth, development, and adaptation to the environment. Furthermore, we highlight their potential biotechnological applications for crop improvement and promoting sustainable agriculture. This review emphasizes the multifaceted roles of PEBP genes, shedding light on their significance in legume biology and their potential for sustainable productive farming.

Catharanthus roseus is a highly relevant model for investigating plant defense mechanisms and the biosynthesis of therapeutically valuable compounds, including terpenoid indole alkaloids (TIAs). It has been demonstrated that beneficial microbial interactions can regulate TIA biosynthesis in C. roseus, highlighting the need to fully comprehend the molecular mechanisms involved to efficiently implement eco-friendly strategies. This study explores the effects of a novel microbial strain, Y503, identified as Sphingomonas sp., on TIA production and the underlying mechanisms in C. roseus. Through bioinformatics analysis, we have identified 17 MAPKKKs, 7 MAPKKs, and 13 MAPKs within the C. roseus genome. Further investigation has verified the presence of the MAPK module (CrMAPKKK1-CrMAPKK1/CrMAPKK2-CrMPK3) mediating Y503 in regulating TIA biosynthesis in C. roseus. This study provides foundational information for strengthening the plant defense system in C. roseus through advantageous microbial interactions, which could contribute to the sustainable cultivation of medicinal plants such as C. roseus.

Plants, being immobile, are exposed to environmental adversities such as wind, snow and animals that damage their structure, making regeneration essential for their survival. The adventitious roots (ARs) primarily emerge from a detached explant to uptake nutrients; therefore, the molecular network involved in their regeneration needs to be explored. DNA methylation, a key epigenetic mark, influences molecular pathways, and recent studies suggested its role in regeneration. In our research, the application of 5-azacytidine (5-azaC), an inhibitor of DNA methylation, caused the earlier initiation and development of root primordia and consequently enhanced the AR regeneration rate in Robinia psuedoacacia L (black locust). The whole-genome bisulfite sequencing (WGBS) revealed a decrease in global methylation and an increase in hypomethylated cytosine sites and regions across all contexts including CHH, CHG and mergedCG caused transcriptional variations in 5-azaC-treated sample. The yeast two-hybrid (Y2H) assay revealed a RpMYB2-centred network of transcriptionally activated transcription factors (TFs) including RpWRKY23, RpGATA23, RpSPL16 and other genes like RpSDP, RpSS1, RpBEN1, RpGULL05 and RpCUV with nuclear localization suggesting their potential co-localization. Additionally, yeast one-hybrid (Y1H) assay showed the interaction of RpMYB2 interactors, RpGATA23 and RpWRKY23, with promoters of RpSK6 and RpCDC48, and luciferase reporting assay (LRA) validated their binding with RpSK6. Our results revealed that hypomethylation-mediated transcriptomic modifications activated the RpMYB2-centred gene network to enhance AR regeneration in black locust hypocotyl cuttings. These findings pave the way for genetic modification to improve plant regeneration ability and increase wood production while withstanding environmental damage.

Heterotrophic microbes rely on host-derived carbon sources for their growth and survival. Depriving pathogens of plant carbon is therefore a promising strategy for protecting plants from disease and reducing yield losses. Importantly, this carbon starvation-mediated resistance is expected to be more broad-spectrum and durable than race-specific R-gene-mediated resistance. Although sugars are well characterized as major carbon sources for bacteria, emerging evidence suggests that plant-derived lipids are likely to be an essential carbon source for some fungal microbes, particularly biotrophs. Here, we comprehensively discuss the dual roles of carbon sources (mainly sugars and lipids) and their transport processes in immune signalling and microbial nutrition. We summarize recent findings revealing the crucial roles of lipids as susceptibility factors at all stages of pathogen infection. In particular, we discuss the potential pathways by which lipids and other plant carbon sources are delivered to biotrophs, including protein-mediated transport, vesicle trafficking and autophagy. Finally, we highlight knowledge gaps and offer suggestions for clarifying the mechanisms that underlie nutrient uptake by biotrophs, providing guidance for future research on the application of carbon starvation-mediated resistance.

Most terrestrial plants can establish a reciprocal symbiosis with arbuscular mycorrhizal (AM) fungi to cope with adverse environmental stresses. The development of AM symbiosis is energetically costly and needs to be dynamically controlled by plants to maintain the association at mutual beneficial levels. Multiple components involved in the autoregulation of mycorrhiza (AOM) have been recently identified from several plant species; however, the mechanisms underlying the feedback regulation of AM symbiosis remain largely unknown. Here, we report that AM colonization promotes the flavonol biosynthesis pathway in tomato (Solanum lycopersicum), and an AM-specific UDP-glucosyltransferase SlUGT132, which probably has the flavonol glycosylation activity, negatively regulates AM development. SlUGT132 was predominantly expressed in the arbuscule-containing cells, and its knockout or knockdown mutants showed increased soluble sugar content, root colonization level and arbuscule formation. Conversely, overexpression of SlUGT132 resulted in declined soluble sugar content and mycorrhization degree. Metabolomic assay revealed decreased contents of astragalin, tiliroside and cynaroside in slugt132 mycorrhizal roots, but increased accumulation of these flavonoid glycosides in SlUGT132-overexpressing plant roots. Our results highlight the presence of a novel, SlUGT132-mediated AOM mechanism, which enable plants to flexibly control the accumulation of soluble sugars and flavonoid glycosides in mycorrhizal roots and modulate colonization levels.

Low temperatures in late spring pose a potential threat to the maintenance of grain yield and quality. Despite the importance of protein and starch in wheat quality, they are often overlooked in models addressing climate change effects. In this study, we conducted multiyear environment-controlled phytotron experiments and observed adverse effects resulting from low-temperature stress (LTS) on plant carbon and nitrogen dynamics, grain protein and starch formation, and sink capacity. We quantified the relationships between low temperature during the jointing and booting stages and plant nitrogen uptake, grain nitrogen accumulation, grain starch accumulation, grain setting, and potential grain weight using source-sink relationship-based methods. The LTS factor was introduced to account for the cultivar-specific to LTS at different growth stages. Compared with the original model, the improved model produced fewer errors when simulating aboveground nitrogen accumulation, grain protein concentration, grain starch concentration, grain starch yield, grain number, and grain weight under LTS, with reductions of 60%, 71%, 73%, 58%, 50% and 65%, respectively. The improvements in the model enhance its mechanism and applicability in assessing short-term successive frost effects on wheat grain quality. Furthermore, when using the improved model, special attention should be given to the low-temperature sensitivity parameters.

Soybean (Glycine max) is the single most important global source of vegetable protein. Yield improvements per unit land area are needed to avoid further expansion onto natural systems. Mesophyll conductance (g_m) quantifies the ease with which CO₂ can diffuse from the sub-stomatal cavity to Rubisco. Increasing g_m is attractive since it increases photosynthesis without increasing water use. Most measurements of g_m have been made during steady-state light saturated photosynthesis. In field crop canopies, light fluctuations are frequent and the speed with which g_m can increase following shade to sun transitions affects crop carbon gain. Is there variability in g_m within soybean germplasm? If so, indirect selection may have indirectly increased g_m during domestication and subsequent breeding for sustainability and yield. A modern elite cultivar (LD11) was compared with four ancestor accessions of Glycine soja from the assumed area of domestication by concurrent measurements of gas exchange and carbon isotope discrimination (∆¹³C). g_m was a significant limitation to soybean photosynthesis both at steady state and through light induction but was twice the value of the ancestors in LD11. This corresponded to a substantial increase in leaf photosynthetic CO₂ uptake and water use efficiency.