Journal of Genetic Engineering and Biotechnology最新文献

{"title":"Assessment of vitamin D status and vitamin D receptor polymorphism in Egyptian children with Type 1 diabetes","authors":"Eman A. Mostafa ,&nbsp;Maha M.A. Abo Hashish ,&nbsp;Nagwa Abdallah Ismail ,&nbsp;Hasanin M. Hasanin ,&nbsp;Rasha M. Hasanin ,&nbsp;Aliaa Ahmed Wahby ,&nbsp;Ingy Ashmawy ,&nbsp;Shereen Hamdy Abd El Aziz ,&nbsp;Mai Magdy Abdel Wahed","doi":"10.1016/j.jgeb.2023.100343","DOIUrl":"https://doi.org/10.1016/j.jgeb.2023.100343","url":null,"abstract":"<div><h3>Background</h3><p>The endocrine system of vitamin D regulates about 3 % of the human genome. Vitamin D exerts its actions via a nuclear vitamin D receptor (VDR) which in turn regulates insulin secretion from the pancreas. VDR gene polymorphisms could have an impact on how autoimmune illnesses like Type 1 diabetes mellitus (T1DM) develop. We aimed to explore the relation between T1DM and VDR gene polymorphisms in Egyptian diabetic children and their siblings.</p></div><div><h3>Methods</h3><p>Enzyme-linked immunosorbent assay was used to quantify 25(OH) vitamin D in the study, which had 179 participants (group 1 = 85 diabetic children, group 2 = 57 siblings of the patients, group 3 = 37 healthy controls). Real-time polymerase chain reaction (RT-PCR) was used to analyze the genotyping of the VDR gene polymorphisms Apa-I (rs7975232), Fok-I (rs2228570), Taq-I (rs731236) and Bsm-I (rs1544410).</p></div><div><h3>Results</h3><p>The mean serum 25(OH) vitamin D levels was significantly lower in T1DM patients (14.99 ± 9.24 ng/mL) and siblings (16.31 ± 7.96 ng/mL) compared to the controls (19.48 ± 7.42 ng/mL) (<em>p</em> = 0.031). The genotypes distribution of VDR Fok-I (rs2228570) and Bsm-I (rs1544410) polymorphisms showed a significant difference between patients, siblings and controls as P = 0.001 and 0.026 respectively, while the VDR ApaI and TaqI polymorphisms did not. FokI-A allele frequency was significantly lower in T1DM patients and siblings than in controls (p &lt; 0.001). FokI-AA genotype had a statistical significant higher vitamin D levels than other genotypes with p value of 0.024.</p></div><div><h3>Conclusion</h3><p>Our study found that T1DM children had lower vitamin D levels, and VDR FokI and BsmI gene polymorphisms were linked to T1DM in Egyptian children. Determining the relationship between vitamin D levels and VDR polymorphisms, particularly the FokI and other genetic analyses may aid in the early diagnosis of T1DM in children.</p></div>","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"22 1","pages":"Article 100343"},"PeriodicalIF":3.5,"publicationDate":"2024-01-22","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.sciencedirect.com/science/article/pii/S1687157X23015147/pdfft?md5=f2e5a59581485fe544704b7ceaf9ba0b&pid=1-s2.0-S1687157X23015147-main.pdf","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139549099","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Acetaminophen-traces bioremediation with novel phenotypically and genotypically characterized 2 Streptomyces strains using chemo-informatics, in vivo, and in vitro experiments for cytotoxicity and biological activity","authors":"Donia H. Embarez, Ahmed S. Abdel Razek, Emad B. Basalious, Magdi Mahmoud, Nadia M. Hamdy","doi":"10.1186/s43141-023-00602-w","DOIUrl":"https://doi.org/10.1186/s43141-023-00602-w","url":null,"abstract":"We isolated two novel bacterial strains, active against the environmental pollutant acetaminophen/Paracetamol®. Streptomyces chrestomyceticus (symbol RS2) and Flavofuscus (symbol M33) collected from El-Natrun Valley, Egypt—water, sediment, and sand samples, taxonomically characterized using a transmission electron microscope (TEM). Genotypic identification, based on 16S rRNA gene sequence analysis followed by BLAST alignment, were deposited on the NCBI as 2 novel strains https://www.ncbi.nlm.nih.gov/nuccore/OM665324 and https://www.ncbi.nlm.nih.gov/nuccore/OM665325 . The phylogenetic tree was constructed. Acetaminophen secondary or intermediate product’s chemical structure was identified by GC/LC MS. Some selected acetaminophen secondary-product extracts and derived compounds were examined against a panel of test micro-organisms and fortunately showed a good anti-microbial effect. In silico chemo-informatics Swiss ADMET evaluation was used in the selected bio-degradation extracts for absorption (gastric), distribution (to CNS), metabolism (hepatic), excretion (renal), and finally not toxic, being non-mutagenic/teratogenic or genotoxic, virtually. Moreover, in vitro cytotoxic activity of these selected bio-degradation secondary products was examined against HepG2 and MCF7 cancer cell lines, where M33 and RS2 extract effects on acetaminophen/paracetamol bio-degradation products were safe, with higher IC50 on HepG2 and MCF7 than the acetaminophen/paracetamol IC50 of 108.5 μg/ml. Moreover, an in vivo oral acute single-dose toxicity experiment was conducted, to confirm these in vitro and in silico lower toxicity (better safety) than acetaminophen/paracetamol.","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"7 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2023-12-19","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"138742884","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"FolE gene expression for folic acid productivity from optimized and characterized probiotic Lactobacillus delbrueckii","authors":"Mohamed Khedr, Fady Sayed Youssef, Noura El-kattan, Mahmoud S. Abozahra, Mohammed N. Selim, Abdullah Yousef, Kamal M. A. Khalil, Alsayed E. Mekky","doi":"10.1186/s43141-023-00603-9","DOIUrl":"https://doi.org/10.1186/s43141-023-00603-9","url":null,"abstract":"Lactobacillus delbrueckii was one of the most common milk lactic acid bacterial strains (LAB) which characterized as probiotic with many health influencing properties. Among seven isolates, KH1 isolate was the best producer of folic acid with 100 µg/ml after 48 h of incubation; FolE gene expression after 24 h of incubation was in the highest value in case of KH1 with three folds. Lactose was the best carbon source for this KH1, besides the best next isolates KH80 and KH98. The selected three LAB isolates were identified through 16S rDNA as Lactobacillus delbrueckii. These three isolates have high tolerance against acidic pH 2–3; they give 45, 10, and 22 CFUs at pH 3, besides 9, 6, and 4 CFUs at pH2, respectively. They also have resistance against elevated bile salt range 0.1–0.4%. KH1 recorded 99% scavenging against 97.3% 1000 µg/ml ascorbic acid. Docking study exhibits the binding mode of folic acid which exhibited an energy binding of − 8.65 kcal/mol against DHFR. Folic acid formed four Pi-alkyl, Pi-Pi, and Pi-sigma interactions with Ala9, Ile7, Phe34, and Ile60. Additionally, folic acid interacted with Glu30 and Asn64 by three hydrogen bonds with 1.77, 1.76, and 1.96 Å. LAB isolates have probiotic properties, antioxidant activity, and desired organic natural source for folic acid supplementation that improve hemoglobin that indicated by docking study interaction. ","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"79 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2023-12-18","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"138716601","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Biosoftening of banana pseudostem fiber using cellulase and pectinase enzyme isolated from Aspergillus niger for textile industry","authors":"Manjusha W. A., Josphine J. S., Deepa P. K., Sujatha S., Ahil Raj S.","doi":"10.1186/s43141-023-00617-3","DOIUrl":"https://doi.org/10.1186/s43141-023-00617-3","url":null,"abstract":"Nowadays, farmers are facing a lot of problems for the disposal of banana pseudostem waste after the harvesting of banana. Banana pseudostem is a rich source of fiber, which is an alternative source of other natural and synthetic fibers. The banana fibers are biodegradable, and they are expected to be in great demand in the international market. For the textile industry, fibers were extracted using chemical and mechanical methods, but it leads to damage and affects the quality of fibers. So, this study mainly focused on biosoftening of banana pseudostem fiber using crude enzyme produced from Aspergillus niger which is one of the most predominant fungus which can synthesize industrially applicable enzymes and which can soften the surface of banana pseudostem fiber. Through this, biosoftened banana pseudostem fiber can be produced, and the disposal problem of banana pseudostem can be rectified in an eco-friendly manner. The present study was undertaken for the biosoftening of banana pseudostem fiber using crude enzymes isolated from fungal strain. The fungal isolates were subjected to enzyme screening such as cellulase, pectinase, chitinase, peroxidase, and polygalacturonase. The maximum production of enzyme was observed in F2 strain, and it was subjected to crude enzyme production and purification using dialysis and column chromatography. The collected best enzyme fractions were selected for the biosoftening of banana pseudostem fiber. The banana pseudostem fiber was treated with crude enzymes at the time duration of 2, 4, 24, and 48 h. After the treatment, the treated and untreated fibers were evaluated for the mechanical properties and chemical constituent’s analysis. The results revealed that the chemical contents were high during 2- and 4-h-treated fibers. After that, chemical constituents were reduced due to the removal of debris by the action of enzymes. The mechanical properties such as breaking load, breaking extension, tenacity, and diameter of fiber were best in the fibers treated for 2 and 4 h. After 4 h due to the removal of chemical constituents the breaking load and tenacity, diameter will be reduced. SEM results proved that the fiber treated at 4th h showed smooth and softened fiber. This study proved that the crude enzymes isolated from the Aspergillus niger can be effectively soften and increase the quality of banana pseudostem fiber.","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"2 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2023-12-18","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"138716606","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence","authors":"Irsyad Ibadurrahman, Suryani, Desriani","doi":"10.1186/s43141-023-00580-z","DOIUrl":"https://doi.org/10.1186/s43141-023-00580-z","url":null,"abstract":"The COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC). The results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500–5,000, 6,500–7,500, and 23,300–25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests. This study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"55 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2023-12-18","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"138716267","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"In silico analysis of HLA-1 and HLA-2 recognition of a designed recombinant human papillomavirus vaccine based on L1 protein HPV subtype 45","authors":"Asri Sulfianti, Nihayatul Karimah, Astutiati Nurhasanah","doi":"10.1186/s43141-023-00593-8","DOIUrl":"https://doi.org/10.1186/s43141-023-00593-8","url":null,"abstract":"Human leukocyte antigen (HLA) can bind and present the processed antigenic peptide derived from the vaccine to the T cell receptor, and this capability is crucial in determining the effectivity of the vaccine to terminate virus-infected cells, activate macrophages, and induce B cells to produce antibodies. A recombinant vaccine candidate based on protein L1 HPV45 was designed and analysed whether it is recognisable by T cells through the binding of their epitopes to HLAs. The study consisted of two parts: part one was the analysis of the L1 recombinant protein binding to HLA-1 and 2 epitopes, whereas part two was the distribution analysis of HPV-linked HLA allele. HLA allele sets found at high frequency in the general population and in specific Indonesian population were listed for the binding analysis of the recombinant L1 HPV45 protein. In part one, immunoepitope servers from IEDB were used to predict the binding of the designed proteins to HLA alleles. The prediction method for MHC-I binding prediction was the NetMHCpan EL 4.1 whilst for MHC-II binding prediction was the Consensus approach. Antigenicity analysis for each peptide was conducted using VaxiJen 2.0 with the threshold 1.0 to select the highly antigenic peptides, and positions of these epitopes in the secondary and tertiary structure of the recombinant protein were also predicted. The percent population coverage of the alleles capable of binding to these epitopes worldwide was also estimated. In part two, the worldwide distribution and frequency of HPV-related HLA-1 and 2 were studied. Two highly antigenic peptides (EEYDLQFIF and KLKFWTVDLK) were recognised by high-frequency HLA-1 alleles in both, the general and Western Javanese. In addition to these two epitopes, a few more peptides are also recognised by the high-frequency Western Javanese HLA-1 alleles, which are not in Weiskopf’s list of high-frequency HLA-1 alleles in the general population. Analysis of the highly antigenic epitopes binding to HLA-DRB1 alleles in general (YIKGTSANM) and Western Javanese (LRRRPTIGP) populations showed that these peptide cores associate to HLA-DRB1*04, albeit the different sub-types, due to the presence of different allele in each population group. Analysis of the epitopes and the positive binding alleles showed on average 25.65% population coverage. The recombinant vaccine candidate based on protein L1 HPV45 is presumed to contain highly antigenic peptides that can bind to high-frequency HLA-1 and 2 alleles present in general and Western Javanese populations. It was expected that the protein is capable of eliciting T cell-mediated responses in both populations; however, in vitro study is needed to prove the protectiveness of the designed recombinant protein.","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"32 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2023-12-13","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"138581211","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"A scalable overexpression of a thermostable recombinant poly-histidine tag carboxyl esterase under lambda promoter: purification, characterization, and protein modelling","authors":"Nadia A. Soliman, Safaa M. Ali, Mahmoud E. A. Duab, Yasser R. Abdel-Fattah","doi":"10.1186/s43141-023-00610-w","DOIUrl":"https://doi.org/10.1186/s43141-023-00610-w","url":null,"abstract":"As a white biotechnological trend, esterases are thought to be among the most active enzymes’ classes in biocatalysis and synthesis of industrially importance organic compounds. Esterases are used in many applications such as the manufacture of pharmaceuticals, cosmetics, leather, textile, paper, food, dairy products, detergents, and treatment of some environmental pollutants. A poly-histidine moiety was added to the C-terminal end of the Geobacillus sp. gene encoding carboxyl esterase (EstB, ac: KJ735452) to facilitate one-step purification. This recombinant protein was successfully expressed in Escherichia coli (E. coli) under control of Lambda promoter (λ). An open reading frame (ORF) of 1500 bps encoding a polypeptide of 499 amino acid residues and a calculated molecular weight (54.7 kD) was identified as carboxyl-esterase B due to its conserved glycine-X-serine-X-glycine motif (G-X-S-X-G) and its high similarity toward other carboxyl esterases, where the 3-D tertiary structure of EstB was determined based on high homology % (94.8) to Est55. The expression was scaled up using 7-L stirred tank bioreactor, where a maximum yield of enzyme was obtained after 3.5 h with SEA 51.76 U/mg protein. The expressed protein was purified until unity using immobilized metal affinity chromatography (IMAC) charged with cobalt and then characterized. The purified enzyme was most active at pH 8.0 and remarkably stable at pH (8–10). Temperature optimum was recorded at 65 °C, and it kept 70% of its activity after 1-h exposure to 60 °C. The active half-live of enzyme was 25 min at 70 °C and a calculated T melting (Tm) at 70 °C. The determined reaction kinetics Michaelis–Menten constant (Km), maximum velocity rate (Vmax), the turnover number (Kcat), and catalytic efficiency (Kcat/Km) of the pure enzyme were found 22.756 mM, 164.47 U/ml (59.6 min−1), and (2.619 mol/ min), respectively. Creation of a recombinant 6 × -His estB derived from a thermophile Geobacillus sp. was performed successfully and then overexpressed under λ-promoter. In a bench scale bioreactor, the overexpression was grown up, followed by one-step purification and biochemical characterization. The recorded promising pH and temperature stability properties suggest that this expressed carboxyl esterase could be used in many industrial sectors.","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"70 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2023-12-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"138572361","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"In silico design of an epitope-based vaccine against PspC in Streptococcus pneumoniae using reverse vaccinology","authors":"Md. Nahian, Muhammad Shahab, Lincon Mazumder, Jonas Ivan Nobre Oliveira, Tanjina Akhtar Banu, Murshed Hasan Sarkar, Barna Goswami, Ahashan Habib, Shamima Begum, Shahina Akter","doi":"10.1186/s43141-023-00604-8","DOIUrl":"https://doi.org/10.1186/s43141-023-00604-8","url":null,"abstract":"Streptococcus pneumoniae is a major pathogen that poses a significant hazard to global health, causing a variety of infections including pneumonia, meningitis, and sepsis. The emergence of antibiotic-resistant strains has increased the difficulty of conventional antibiotic treatment, highlighting the need for alternative therapies such as multi-epitope vaccines. In this study, immunoinformatics algorithms were used to identify potential vaccine candidates based on the extracellular immunogenic protein Pneumococcal surface protein C (PspC). The protein sequence of PspC was retrieved from NCBI for the development of the multi-epitope vaccine (MEV), and potential B cell and T cell epitopes were identified. Linkers including EAAAK, AAY, and CPGPG were used to connect the epitopes. Through molecular docking, molecular dynamics, and immunological simulation, the affinity between MEV and Toll-like receptors was determined. After cloning the MEV construct into the PET28a ( +) vector, SnapGene was used to achieve expression in Escherichia coli. The constructed MEV was discovered to be stable, non-allergenic, and antigenic. Microscopic interactions between ligand and receptor are confirmed by molecular docking and molecular dynamics simulation. The use of an in-silico cloning approach guarantees the optimal expression and translation efficiency of the vaccine within an expression vector. Our study demonstrates the potential of in silico approaches for designing effective multi-epitope vaccines against S. pneumoniae. The designated vaccine exhibits the required physicochemical, structural, and immunological characteristics of a successful vaccine against SPN. However, laboratory validation is required to confirm the safety and immunogenicity of the proposed vaccine design.","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"86 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2023-12-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"138572123","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Correction: Mycosynthesis of silver nanoparticles using marine fungi and their antimicrobial activity against pathogenic microorganisms","authors":"Manar A. Basheer, Khaled Abutaleb, Nermine N. Abed, Amal A. I. Mekawey","doi":"10.1186/s43141-023-00625-3","DOIUrl":"https://doi.org/10.1186/s43141-023-00625-3","url":null,"abstract":"<p><b>Correction: J Genet Eng Biotechnol 21, 127 (2023)</b></p><p><b>https://doi.org/10.1186/s43141-023-00572-z</b></p><p>In the original version of this article [1], affiliations 3 and 4 were transposed due to a typesetting error. The affiliations appear correctly in this erratum, and the original article has been corrected.</p><ol data-track-component=\"outbound reference\"><li data-counter=\"1.\"><p>Basheer MA, Abutaleb K, Abed NN et al (2023) Mycosynthesis of silver nanoparticles using marine fungi and their antimicrobial activity against pathogenic microorganisms. J Genet Eng Biotechnol 21:127. https://doi.org/10.1186/s43141-023-00572-z</p><p>Article Google Scholar </p></li></ol><p>Download references<svg aria-hidden=\"true\" focusable=\"false\" height=\"16\" role=\"img\" width=\"16\"><use xlink:href=\"#icon-eds-i-download-medium\" xmlns:xlink=\"http://www.w3.org/1999/xlink\"></use></svg></p><h3>Authors and Affiliations</h3><ol><li><p>National Authority for Remote Sensing and Space Sciences (NARSS), 23 Joseph Tito Street, El‑Nozha El‑Gedida, Cairo, 1564, Egypt</p><p>Manar A. Basheer &amp; Khaled Abutaleb</p></li><li><p>Agricultural Research Council, Natural Resources and Engineering (ARC-NRE), Pretoria, 0001, South Africa</p><p>Khaled Abutaleb</p></li><li><p>School of Animal, Plant and Environmental Sciences, University of Witwatersrand, Private Bag X3, Johannesburg, 2050, South Africa</p><p>Khaled Abutaleb</p></li><li><p>Faculty of Science (Girls Branch), Al-Azhar University Egypt, Cairo, 11884, Nasr City, Egypt</p><p>Nermine N. Abed</p></li><li><p>The Regional Center of Mycology and Biotechnology, Al-Azhar University, Cairo, 4434010, Egypt</p><p>Amal A. I. Mekawey</p></li></ol><span>Authors</span><ol><li><span>Manar A. Basheer</span>View author publications<p>You can also search for this author in <span>PubMed<span> </span>Google Scholar</span></p></li><li><span>Khaled Abutaleb</span>View author publications<p>You can also search for this author in <span>PubMed<span> </span>Google Scholar</span></p></li><li><span>Nermine N. Abed</span>View author publications<p>You can also search for this author in <span>PubMed<span> </span>Google Scholar</span></p></li><li><span>Amal A. I. Mekawey</span>View author publications<p>You can also search for this author in <span>PubMed<span> </span>Google Scholar</span></p></li></ol><h3>Corresponding author</h3><p>Correspondence to Manar A. Basheer.</p><p><b>Open Access</b> This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the articl","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"60 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2023-12-08","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"138555120","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"The Future of Biotechnology and Genetic Engineering in Plants","authors":"Y. Tourte","doi":"10.1201/9780429187643-6","DOIUrl":"https://doi.org/10.1201/9780429187643-6","url":null,"abstract":"","PeriodicalId":53463,"journal":{"name":"Journal of Genetic Engineering and Biotechnology","volume":"23 1","pages":""},"PeriodicalIF":3.5,"publicationDate":"2019-03-29","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"83243926","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}