Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5415
M. Aljohani, Ibrahim Binmuhainy, Mohammed Aljarbou, Fahd Algaeed, Noura Abbatain, Norah Almajed
Objectives: We assessed the attitudes of emergency department (ED) consultants toward family presence during resuscitation (FPDR), to elucidate and provide proof of the benefits of allowing FPDR in Kingdom of Saudi Arabia. Methods: A cross-sectional descriptive study using a questionnaire electronically sent to all ED consultants from five major government hospitals in Riyadh, Saudi Arabia. The survey examined the consultants' beliefs and perception of FPDR, legalities, policies and the effects and outcomes of FPDR on the patient, family, and themselves. Results: The survey received 172 responses, 55.0% were 36–45 years old and 144 (83.7%) were men. Most respondents (91.36%) had experienced FPDR. Less than half (40.1%) believed that FPDR is beneficial to the patient, and 58.7% believed that FPDR could cause difficulties for the resuscitation team. A written policy for FPDR was preferred by 42% of respondents. Significantly more respondents 36-45 years old recommend allowing FPDR compared to other age groups, and significantly more male consultants in this age group believe there is a positive outcome of FPDR. Conclusion: The attitude and perception of emergency consultants towards the practice of FPDR was less positive than expected. Many consultants did not favor the advantages of FPDR, and were worried about negative outcomes, potential medico-legal repercussions, and the unpleasant experience for the family members, especially female consultants. However, a larger proportion of consultants nevertheless recommend FPDR. The ability of ED doctors to manage FPDR and their understanding of the benefits of FPDR needs to be strengthened.
{"title":"The attitudes of Emergency Department consultants toward family presence during resuscitation","authors":"M. Aljohani, Ibrahim Binmuhainy, Mohammed Aljarbou, Fahd Algaeed, Noura Abbatain, Norah Almajed","doi":"10.56293/ijasr.2022.5415","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5415","url":null,"abstract":"Objectives: We assessed the attitudes of emergency department (ED) consultants toward family presence during resuscitation (FPDR), to elucidate and provide proof of the benefits of allowing FPDR in Kingdom of Saudi Arabia. Methods: A cross-sectional descriptive study using a questionnaire electronically sent to all ED consultants from five major government hospitals in Riyadh, Saudi Arabia. The survey examined the consultants' beliefs and perception of FPDR, legalities, policies and the effects and outcomes of FPDR on the patient, family, and themselves. Results: The survey received 172 responses, 55.0% were 36–45 years old and 144 (83.7%) were men. Most respondents (91.36%) had experienced FPDR. Less than half (40.1%) believed that FPDR is beneficial to the patient, and 58.7% believed that FPDR could cause difficulties for the resuscitation team. A written policy for FPDR was preferred by 42% of respondents. Significantly more respondents 36-45 years old recommend allowing FPDR compared to other age groups, and significantly more male consultants in this age group believe there is a positive outcome of FPDR. Conclusion: The attitude and perception of emergency consultants towards the practice of FPDR was less positive than expected. Many consultants did not favor the advantages of FPDR, and were worried about negative outcomes, potential medico-legal repercussions, and the unpleasant experience for the family members, especially female consultants. However, a larger proportion of consultants nevertheless recommend FPDR. The ability of ED doctors to manage FPDR and their understanding of the benefits of FPDR needs to be strengthened.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"80771268","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5511
M. H. Saad
The results of studies conducted on some skin-lightening creams in the Saudi market indicated that they contain heavy metals in varying proportions that exceed the limits recommended by the World Health Organization, which may cause danger to human health. The study focused on three types of skin-lightening creams, namely Fair & Lovely, Rose, and Diana, to estimate their absorption percentages. In general, the results showed that the relationship between the absorbance rate of skin lightening creams and the wavelength is an inverse relationship, where the absorbance rate decreases with the increase in wavelength. For samples treated with ferment only for skin-lightening creams, the cream with the highest absorption value was Fair & Lovely cream, and the lowest absorption value was Rose cream. In addition, for untreated cream samples, Rose cream had the highest absorption, while Fair & Lovely cream recorded the lowest absorption value. In addition, the samples of creams to which olive oil was added only, without exposure to any other factors, had almost the same absorbance value. Moreover, the samples of creams that were exposed to sunlight varied in their absorbance values, as Rose cream recorded the highest absorption value and Fair & Lovely cream had the lowest absorption value. In the samples of creams that were exposed to X-rays, the results showed that the Diana cream sample and the Rose cream sample had the same pattern and behavior in absorbance.UV spectroscopy (Genesys 10S UV-Vis spectrophotometer) was used.
{"title":"Evaluation of the UV absorbance of sum skin lighting creams","authors":"M. H. Saad","doi":"10.56293/ijasr.2022.5511","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5511","url":null,"abstract":"The results of studies conducted on some skin-lightening creams in the Saudi market indicated that they contain heavy metals in varying proportions that exceed the limits recommended by the World Health Organization, which may cause danger to human health. The study focused on three types of skin-lightening creams, namely Fair & Lovely, Rose, and Diana, to estimate their absorption percentages. In general, the results showed that the relationship between the absorbance rate of skin lightening creams and the wavelength is an inverse relationship, where the absorbance rate decreases with the increase in wavelength. For samples treated with ferment only for skin-lightening creams, the cream with the highest absorption value was Fair & Lovely cream, and the lowest absorption value was Rose cream. In addition, for untreated cream samples, Rose cream had the highest absorption, while Fair & Lovely cream recorded the lowest absorption value. In addition, the samples of creams to which olive oil was added only, without exposure to any other factors, had almost the same absorbance value. Moreover, the samples of creams that were exposed to sunlight varied in their absorbance values, as Rose cream recorded the highest absorption value and Fair & Lovely cream had the lowest absorption value. In the samples of creams that were exposed to X-rays, the results showed that the Diana cream sample and the Rose cream sample had the same pattern and behavior in absorbance.UV spectroscopy (Genesys 10S UV-Vis spectrophotometer) was used.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"79143368","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5505
Michelle S. Suelo, Aprille Joy M. Luceno 2, Alma B. Mohagan, Reggie Y. Dela Cruz
The study was conducted for the identification of selected species of family sphingidae through DNA Barcoding in Mt. Kitanglad Lirongan, Lantapan, Bukidnon, Philippines. Thirteen species were collected namely: Acherontia lachesis, Agrius convolvuli, Ambulyx staudingeri, Amplypterus panopus mindanaoensis, Daphnis hypothous, Gnathothlibus erotus erotus, Hippotion brunneum, Hippotion echeclus, Psilogramma menephron, Theretra nessus, Theretra rhesus, Theretra manilae and Theretra sugii. Isolation of the genomic DNA was carried out using the QIAGEN Blood & Tissue Kit. Mitochondrial cytochrome oxidase (COI) gene amplification was carried out using LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) primers producing 656-666 base pairs were obtained from 30 samples of sphingid moth species. BLAST analyses were able to identify sphingid to the species level. BLAST hits of COI gene sequence of all 10 species ranged from 95%-99% similarity. Maximum likelihood (ML) and Bayesian inference (BI) was used to examine phylogenetic signals in COI with the highest bootstrap values. Sphingid moths formed a monophyletic group based on the clade.
{"title":"Molecular Identification of Hawkmoths (Lepidoptera: Sphingidae) in Selected Areas of Mt. Kitanglad Based on Cytochrome Oxidase Subunit I (COI) Gene Sequence","authors":"Michelle S. Suelo, Aprille Joy M. Luceno 2, Alma B. Mohagan, Reggie Y. Dela Cruz","doi":"10.56293/ijasr.2022.5505","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5505","url":null,"abstract":"The study was conducted for the identification of selected species of family sphingidae through DNA Barcoding in Mt. Kitanglad Lirongan, Lantapan, Bukidnon, Philippines. Thirteen species were collected namely: Acherontia lachesis, Agrius convolvuli, Ambulyx staudingeri, Amplypterus panopus mindanaoensis, Daphnis hypothous, Gnathothlibus erotus erotus, Hippotion brunneum, Hippotion echeclus, Psilogramma menephron, Theretra nessus, Theretra rhesus, Theretra manilae and Theretra sugii. Isolation of the genomic DNA was carried out using the QIAGEN Blood & Tissue Kit. Mitochondrial cytochrome oxidase (COI) gene amplification was carried out using LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) primers producing 656-666 base pairs were obtained from 30 samples of sphingid moth species. BLAST analyses were able to identify sphingid to the species level. BLAST hits of COI gene sequence of all 10 species ranged from 95%-99% similarity. Maximum likelihood (ML) and Bayesian inference (BI) was used to examine phylogenetic signals in COI with the highest bootstrap values. Sphingid moths formed a monophyletic group based on the clade.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75567419","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5473
Dudi Permana, Rizal Aditya, Hasliza Abdul Halim
The research aims to identity the sharia bank customer behavior viewed from the perspective of religiosity, knowledge, and advertising. The subjects in this study were people in DKI Jakarta. The sample used in this study was 160 respondents. The sampling technique using a convenience sampling. By using quantitative descriptive approach. Therefore, the analysis of the data used is the statistical analysis in the form of SEM-PLS. The results of this study showed Religiosity has a significant positive effect on the intention to becoming a customer. Knowledge haven’t been a significant effect on the intention to a becoming customer and Advertising has a significant positive effect on the intention to becoming a customer.
{"title":"Model Indonesian Islamic Banking Consumer Behaviour from the View of Religiosity, Knowledge and Advertising","authors":"Dudi Permana, Rizal Aditya, Hasliza Abdul Halim","doi":"10.56293/ijasr.2022.5473","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5473","url":null,"abstract":"The research aims to identity the sharia bank customer behavior viewed from the perspective of religiosity, knowledge, and advertising. The subjects in this study were people in DKI Jakarta. The sample used in this study was 160 respondents. The sampling technique using a convenience sampling. By using quantitative descriptive approach. Therefore, the analysis of the data used is the statistical analysis in the form of SEM-PLS. The results of this study showed Religiosity has a significant positive effect on the intention to becoming a customer. Knowledge haven’t been a significant effect on the intention to a becoming customer and Advertising has a significant positive effect on the intention to becoming a customer.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"88152664","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5456
Priscilla Queen KPAREVZUA, Henry Demenongo ABAYA
Gender roles are defined based on different expectations that people have of others based on their sex, societalvalues and beliefs about gender, which give cues about what sort of behaviour is appropriate for what sex. Extant literature show stereotypical gender roles in politics and diverse professional circles that mostly indicate women as subservient and dependent on men and men as chauvinists. What remains uncertain is the level with which Christian communities understand and interpret biblical gender roles and appropriate them. This study investigates select Christian sects in Jos to determine the depiction and assigning of gender roles within their communities and ascertain how societal and biblical values and beliefs determine how the female gender is particularly perceived and treated in the communities. A quasi-experimental and survey approach is adopted using interviews, questionnaires and observations amongst the clergy and laity of diverse Christian sects to elicit information on gender roles in Christian communities and the data subjected to critical discourse analysis from the Discourse Historical Approach of Ruth Wodak. The study offers profound insight into how women roles are constructed and deconstructed in religious hierarchy on the basis of sameness and the construction of differences and exclusion.
{"title":"WOMEN DEPICTION AND TRADITIONAL GENDER ROLES IN BIBLICAL AND SELECT CHRISTIAN COMMUNITIES IN JOS","authors":"Priscilla Queen KPAREVZUA, Henry Demenongo ABAYA","doi":"10.56293/ijasr.2022.5456","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5456","url":null,"abstract":"Gender roles are defined based on different expectations that people have of others based on their sex, societalvalues and beliefs about gender, which give cues about what sort of behaviour is appropriate for what sex. Extant literature show stereotypical gender roles in politics and diverse professional circles that mostly indicate women as subservient and dependent on men and men as chauvinists. What remains uncertain is the level with which Christian communities understand and interpret biblical gender roles and appropriate them. This study investigates select Christian sects in Jos to determine the depiction and assigning of gender roles within their communities and ascertain how societal and biblical values and beliefs determine how the female gender is particularly perceived and treated in the communities. A quasi-experimental and survey approach is adopted using interviews, questionnaires and observations amongst the clergy and laity of diverse Christian sects to elicit information on gender roles in Christian communities and the data subjected to critical discourse analysis from the Discourse Historical Approach of Ruth Wodak. The study offers profound insight into how women roles are constructed and deconstructed in religious hierarchy on the basis of sameness and the construction of differences and exclusion.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"77281320","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5494
Mealin Grace B. Pacle, Janice Apura, Russel Joy C. Paran, Denis A. Tan
Lived experiences from diverse contexts can be transformational in education. Learning science is intertwined with various experiences, which consequently strengthen the formation of a science concept, thereby increasing students' performance in school. Thus, this paper sought to explore the lived experiences of senior high school students in learning science. Based on this concept, the researchers employed the phenomenological technique of qualitative methodologies to collect complex data regarding students' experiences in science subjects in a blended learning environment and to grasp the phenomenon from their perspective. The study revealed four distinct themes in the students' lives: (1) varied experiences of students in learning the science subject during the pandemic, (2) challenges encountered, (3) coping strategies employed, and (4) resources needed in learning science. Based on the findings, the student's learning experiences were affected by the academic experience, motivation, preparedness, and support. The difficulties encountered by learners in learning science subjects during the new normal can be classified as personal, social, mental, and academic difficulties caused by the abrupt transition from face-to-face to blended learning. Teachers and parents are urged to assist the students, and educational resources must be well prepared. Students must also create new and productive study habits to face further endeavors in learning
{"title":"A Phenomenological Study of the Lived Experiences of Senior High School Students in Learning Science Subjects in the New Normal","authors":"Mealin Grace B. Pacle, Janice Apura, Russel Joy C. Paran, Denis A. Tan","doi":"10.56293/ijasr.2022.5494","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5494","url":null,"abstract":"Lived experiences from diverse contexts can be transformational in education. Learning science is intertwined with various experiences, which consequently strengthen the formation of a science concept, thereby increasing students' performance in school. Thus, this paper sought to explore the lived experiences of senior high school students in learning science. Based on this concept, the researchers employed the phenomenological technique of qualitative methodologies to collect complex data regarding students' experiences in science subjects in a blended learning environment and to grasp the phenomenon from their perspective. The study revealed four distinct themes in the students' lives: (1) varied experiences of students in learning the science subject during the pandemic, (2) challenges encountered, (3) coping strategies employed, and (4) resources needed in learning science. Based on the findings, the student's learning experiences were affected by the academic experience, motivation, preparedness, and support. The difficulties encountered by learners in learning science subjects during the new normal can be classified as personal, social, mental, and academic difficulties caused by the abrupt transition from face-to-face to blended learning. Teachers and parents are urged to assist the students, and educational resources must be well prepared. Students must also create new and productive study habits to face further endeavors in learning","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"86161268","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5448
Nkongolo Mulambwila Michel
It has been clearly established that organic matter provides crops with not only nutrients, although in a lower proportion compared to mineral fertilizers, it releases them slowly and gradually. In addition, it also improves the other characteristics of the soil and thus further conditions the fertility of the soil. Consequently, the study of organic manure should not only be limited to the analysis of its effects on the development and yield of crops, it should also extend to the examination of its impact on the maintenance or increasing soil fertility.
{"title":"Assessment of residual effects of organic manures (Tithonia diversifolia and bat-guano) on maize cultivation in the Ngandajika region in central DR Congo","authors":"Nkongolo Mulambwila Michel","doi":"10.56293/ijasr.2022.5448","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5448","url":null,"abstract":"It has been clearly established that organic matter provides crops with not only nutrients, although in a lower proportion compared to mineral fertilizers, it releases them slowly and gradually. In addition, it also improves the other characteristics of the soil and thus further conditions the fertility of the soil. Consequently, the study of organic manure should not only be limited to the analysis of its effects on the development and yield of crops, it should also extend to the examination of its impact on the maintenance or increasing soil fertility.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75639012","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5446
Monica Henny Sudaryati
Basic Training for Civil Servant Candidates is held to develop competencies that are carried out in an integrated manner. Procurement of Candidates for Civil Servants at the Ministry of Religion to obtain State Civil Apparatus who have personal characteristics as public service providers, with skills, expertise, and behavior in accordance with the demands of the position for the advancement of the institution. The digital era has brought about changes in prospective Civil Servants to become State Civil Apparatuses that are specific, measurable, achievable, relevant, and time-bound (SMART) This research was conducted at the Jakarta Religious Education and Training Center. The purpose of this study is to determine the implementation of Civil Servant Candidates who become public servants to move faster and rise stronger in the digital era towards a State Civil Apparatus that is Specific, Measurable, Achievable, Relevant, And Time-Bound. This research method is a qualitative approach. Data collection techniques used are observation, interviews and documentation. The results indicate that prospective civil servants already have positions in accordance with the required qualifications and have moved faster in line with the mastery of technology they already have and the speed with which they capture information in the digital era. Increasing self-competence has implications for public servants to build and develop professionalism and SMART of State Civil Apparatus.
{"title":"IMPLEMENTATION OF PROSPECTIVE CIVIL SERVANTS AS PUBLIC SERVICES TO MOVE FASTER, RISE UP STRONGER IN THE DIGITAL ERA TOWARDS SPECIFIC, MEASURABLE, ACHIEVABLE, RELEVANT, AND TIME-BOUND CIVIL SERVANTS","authors":"Monica Henny Sudaryati","doi":"10.56293/ijasr.2022.5446","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5446","url":null,"abstract":"Basic Training for Civil Servant Candidates is held to develop competencies that are carried out in an integrated manner. Procurement of Candidates for Civil Servants at the Ministry of Religion to obtain State Civil Apparatus who have personal characteristics as public service providers, with skills, expertise, and behavior in accordance with the demands of the position for the advancement of the institution. The digital era has brought about changes in prospective Civil Servants to become State Civil Apparatuses that are specific, measurable, achievable, relevant, and time-bound (SMART) This research was conducted at the Jakarta Religious Education and Training Center. The purpose of this study is to determine the implementation of Civil Servant Candidates who become public servants to move faster and rise stronger in the digital era towards a State Civil Apparatus that is Specific, Measurable, Achievable, Relevant, And Time-Bound. This research method is a qualitative approach. Data collection techniques used are observation, interviews and documentation. The results indicate that prospective civil servants already have positions in accordance with the required qualifications and have moved faster in line with the mastery of technology they already have and the speed with which they capture information in the digital era. Increasing self-competence has implications for public servants to build and develop professionalism and SMART of State Civil Apparatus.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"77888778","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2022-01-01DOI: 10.56293/ijasr.2022.5449
M. Suiçmez
As a result of the effect of various factors on aquatic ecosystems, polluting agents such as many heavy metals are mixed, and as a result, the living creatures in the aquatic ecosystem are adversely affected because of contamination with these chemical agents. In recent years, it is important to monitor living organisms and their metabolic processes to determine the cleanliness of water. Therefore, in our study, malondialdehyde (MDA), glutathione (GSH), and Total Antioxidant Status (TAS) which is an oxidative stress marker in the gills, liver, and lungs of Cyprinus Carpio L., which is widely found in the Obruk Dam Lake in Oğuzlar district of Çorum province? A total of 90 Cyprinus carpio specimens were collected from different parts of the Obruk Dam Lake. Relevant tissues of the samples were taken and homogenized. Methods suitable for spectrophotometric measurement were used to determine MDA, GSH and TAS levels. According to the results, it was determined that antioxidant biomarkers were higher in the liver and gills. According to the data obtained from our previous studies, it is reported that the water of the Obruk Dam Lake complies with the standards in terms of heavy metals. These data showed that the physiological events that occur in the relevant tissues to provide oxidative balance contribute to the stabilization of the aquatic ecosystem.
{"title":"Oxidative Stress Mechanism Developed Against Environmental Conditions in Aquatic Organisms: Cyprinus Carpio L. (freshwater fish)","authors":"M. Suiçmez","doi":"10.56293/ijasr.2022.5449","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5449","url":null,"abstract":"As a result of the effect of various factors on aquatic ecosystems, polluting agents such as many heavy metals are mixed, and as a result, the living creatures in the aquatic ecosystem are adversely affected because of contamination with these chemical agents. In recent years, it is important to monitor living organisms and their metabolic processes to determine the cleanliness of water. Therefore, in our study, malondialdehyde (MDA), glutathione (GSH), and Total Antioxidant Status (TAS) which is an oxidative stress marker in the gills, liver, and lungs of Cyprinus Carpio L., which is widely found in the Obruk Dam Lake in Oğuzlar district of Çorum province? A total of 90 Cyprinus carpio specimens were collected from different parts of the Obruk Dam Lake. Relevant tissues of the samples were taken and homogenized. Methods suitable for spectrophotometric measurement were used to determine MDA, GSH and TAS levels. According to the results, it was determined that antioxidant biomarkers were higher in the liver and gills. According to the data obtained from our previous studies, it is reported that the water of the Obruk Dam Lake complies with the standards in terms of heavy metals. These data showed that the physiological events that occur in the relevant tissues to provide oxidative balance contribute to the stabilization of the aquatic ecosystem.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78349762","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
The trial focused on the multiplication of pineapple suckers obtained from their cut stems and grown in trays under 3 treatments with 4 repetitions. The objective of the trial is to test the efficiency of the multiplication of pineapple shoots on the three culture substrates. The experimental device is completely randomized. The T1 treatment consists of cow dung, decomposed plant debris, landfill sand, coarse coconut fibers and those partially powdered. The T2 treatment consists of coarse coconut fibers and those partially powdered. The T3 treatment consists only of white sawdust. The results obtained showed that, 30 days before weaning, the high number of rejections (7.62±2.25) was obtained from the T1 treatment. The pineapple stems of treatments T2 and T3 gave respectively 5.56±2.06 and 6.69±3.38 rejections. At the 4th weaning, the rods of the T1 treatment gave more rejections (10.50 ± 1.29) than those of the T2 and T3 treatments which gave only 8.25 ± 0.96 and 9.50 ± 1 respectively 29 rejections. The suckers of the T1 treatment produced more leaves (22.75±0.96) on the 60th day after the 4th weaning than those of the T2 and T3 treatments which produced only 20.25±0.5 and 22± respectively. 0.82 sheets. They also weighed more (69.57±0.99g) than those of the T2 and T3 treatments which each gave 49.57±1.87g. Thus the approach of the T1 substrate improved the number of suckers, that of the leaves as well as the mass of the suckers.
{"title":"EFFECTIVENESS TEST OF THE MULTIPLICATION TECHNIQUE OF PINEAPPLE DISCHARGES (ANANAS COMOSUS) ON THREE GROWING SUBSTRATES","authors":"Tchaniley Larounga, Ouagbeni Amina Ivètte, Tagba Essognim","doi":"10.56293/ijasr.2022.5422","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5422","url":null,"abstract":"The trial focused on the multiplication of pineapple suckers obtained from their cut stems and grown in trays under 3 treatments with 4 repetitions. The objective of the trial is to test the efficiency of the multiplication of pineapple shoots on the three culture substrates. The experimental device is completely randomized. The T1 treatment consists of cow dung, decomposed plant debris, landfill sand, coarse coconut fibers and those partially powdered. The T2 treatment consists of coarse coconut fibers and those partially powdered. The T3 treatment consists only of white sawdust. The results obtained showed that, 30 days before weaning, the high number of rejections (7.62±2.25) was obtained from the T1 treatment. The pineapple stems of treatments T2 and T3 gave respectively 5.56±2.06 and 6.69±3.38 rejections. At the 4th weaning, the rods of the T1 treatment gave more rejections (10.50 ± 1.29) than those of the T2 and T3 treatments which gave only 8.25 ± 0.96 and 9.50 ± 1 respectively 29 rejections. The suckers of the T1 treatment produced more leaves (22.75±0.96) on the 60th day after the 4th weaning than those of the T2 and T3 treatments which produced only 20.25±0.5 and 22± respectively. 0.82 sheets. They also weighed more (69.57±0.99g) than those of the T2 and T3 treatments which each gave 49.57±1.87g. Thus the approach of the T1 substrate improved the number of suckers, that of the leaves as well as the mass of the suckers.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"77697450","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
京公网安备 11010802042870号
京ICP备2023020795号-1
扫码关注我们
求助内容：
应助结果提醒方式：