Journal of cellular biochemistry最新文献

Cover Caption: The cover image is based on the article SARS-CoV-2 Spike Protein Induces Time-Dependent CTSL Upregulation in HeLa Cells and Alveolarspheres by Magdalena M. Bolsinger et al., https://doi.org/10.1002/jcb.30627.

RETRACTION: I. Tajmohammadi, J. Mohammadian, M. Sabzichi, S. Mahmuodi, M. Ramezani, M. Aghajani, and F. Ramezani, “Identification of Nrf2/STAT3 Axis in Induction of Apoptosis Through Sub-G₁ Cell Cycle Arrest Mechanism in HT-29 Colon Cancer Cells,” Journal of Cellular Biochemistry 120, no. 8 (2019): 14035–14043, https://doi.org/10.1002/jcb.28678.

The above article, published online on 16 April 2019 in Wiley Online Library (wileyonlinelibrary.com) has been retracted by agreement between the journal Editor-in-Chief, Christian Behl; and Wiley Periodicals, LLC. The retraction has been agreed due to concerns raised by a third party on the data presented in the article. Specifically, some image elements in Figure 4, where found to have been published elsewhere in a different scientific context. The authors did not provide a satisfactory explanation to address the concerns. For these reasons, the editors have lost trust in the accuracy and integrity of the full body of data presented in the article and consider its conclusions invalid.

All authors have been informed of the decision of retraction. The corresponding author Fatemeh Ramezani, first author Issa Tajmohammadi, and Coauthor Mehdi Sabzichi disagree with the decision of retraction. Coauthor Marjan Aghajani has stated that she did not directly participate in the experiments conducted for the study, and that her role was limited to manuscript editing and language polishing; she neither agreed nor disagreed with the decision of retraction. No confirmation was obtained by the remaining co-authors.

Li Y, He J, Qiu C, et al. The oncolytic virus H101 combined with GNAQ siRNA-mediated knockdown reduces uveal melanoma cell viability. J Cell Biochem. 2019;120:5766-5776. https://doi.org/10.1002/jcb.27863.

In the original version of this article, the authors mistakenly duplicated panels in Figure 2A showing the morphological changes of OMM2.3 cells treated with “H101” and “H101+siNC,” as well as in Figure 3A, showing the flow cytometric analysis of OMM2.3 cells in the “NC” and “siGNAQ” groups. In the corrected Figures 2A and 3A below, the authors have replaced the duplicated “H101+siNC” and “siGNAQ” panels with the correct ones, respectively. Additionally, in the correct Figure 3 below, the axis labels have been corrected from “PMT4 Log” to “PI” (Propidium Iodide) and from “PMT2 Log” to “Annexin V-FITC”.

The legend for Figure 3 is corrected as per below (changes in bold):

Figure 3. Apoptosis was modulated by cotreatment with H101 and siGNAQ. A, Apoptosis of the OMM2.3, 92.1, and OCM1 cell lines was detected with an annexin-V kit and a flow-cytometric analysis. B, At 48 h after transfection, the proportion of early apoptotic cells (Annexin V⁺ PI^-) was calculated. When H101 was combined with siGNAQ, the apoptosis of UM cells was enhanced relative to that induced by H101 alone. The results are presented as the means and standard error of the mean; *P < 0.05. UM, uveal melanoma.

Additionally, there is a typographical error in the sequence of the reverse primer for GADPH amplification. The correct sequence is “CAAAGTTGTCATGGATGACC”.

Finally, the author omitted to mention that the bands for GNAQ and β-actin in Figure 5A are referenced from Figure 1C.

The authors apologize for these mistakes and for any inconvenience these may have caused.

RETRACTION: W. Wang, M. Huang, Y. Hui, P. Yuan, X. Guo, and K. Wang, “Cryptotanshinone Inhibits RANKL-induced Osteoclastogenesis by Regulating ERK and NF-κB Signaling Pathways,” Journal of Cellular Biochemistry 120, no. 5 (2019): 7333-7340, https://doi.org/10.1002/jcb.28008.

The above article, published online on 2 December 2018 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors; the journal Editor-in-Chief, Christian Behl; and Wiley Periodicals LLC. The retraction has been agreed due to concerns raised by third parties on the data presented in the article. Specifically, several image elements in Figure 1 C were found to have been sourced from a previously published article by a different author group and inappropriately edited. Finally, inappropriate post-acquisition splicing has been detected in the Western Blot experiment depicted in Figure 5 A. The article has been retracted as the editors have lost trust in the overall accuracy of the presented data, and consider the conclusions to be invalid. The authors agree with the decision of retraction and apologize for any inconvenience caused.

RETRACTION: K. Mortezaee, J. Majidpoor, E. Daneshi, M. Abouzaripour, and M. Abdi, “Posttreatment of Melatonin With CCl4 Better Reduces Fibrogenic and Oxidative Changes in Liver Than Melatonin Co-treatment,” Journal of Cellular Biochemistry 119, no. 2 (2018): 1716-1725, https://doi.org/10.1002/jcb.26331.

The above article, published online on 7 August 2017 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor-in-Chief, Christian Behl; and Wiley Periodicals LLC. The retraction has been agreed upon due to concerns about the accuracy of the data presented in the article. The authors informed the journal of significant errors in the compilation of Figure 2. Subsequent investigation by the publisher revealed that several image elements in Figure 2 had been previously published by the same author group to illustrate different staining and/or treatment. The authors acknowledged that these mistakes may have resulted from problems in data management while performing similar experiments for different research projects. Therefore, due to the concerns on data accuracy, the editors consider the conclusions of this article to be invalid.

RETRACTION: Y. Zhou, L. Wei, H. Zhang, Q. Dai, Z. Li, B. Yu, et al., “FV-429 Induced Apoptosis Through ROS-Mediated ERK2 Nuclear Translocation and p53 Activation in Gastric Cancer Cells,” Journal of Cellular Biochemistry 116, no. 8 (2015): 1624–1637, https://doi.org/10.1002/jcb.25118.

The above article, published online on 3 February 2015 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the journal Editor-in-Chief, Christian Behl; and Wiley Periodicals LLC. The retraction has been agreed due to concerns raised by third parties related to the data presented in the article. Specifically, duplication of Western Blot images has been detected across Figures 5D and 6A; and 5B, 6B and 6I. Furthermore, inappropriate post-acquisition modifications have been detected within Figure 4B and 4F, and image elements in Figure 4B and 4E were found to have been previously published by the same author group in a different scientific context. The authors were unable to provide the relative raw data upon request. Finally, the cell lines used in this study (BGC-823 and MGC-803) have been reported as contaminated [1-4]. Therefore, retraction has been agreed upon as the editors consider the conclusions of this article to be invalid. The authors have been informed of the decision of retraction but unavailable for a final confirmation.

The lack of amino acids triggers the autophagic response. Some studies have shown such starvation conditions also induce mitochondrial fusion, revealing a close correlation between the two processes. Although Mitofusin-2 (MFN2) has been demonstrated to play a role in fusion regulation, its role in the autophagic response and the variables that activate MFN2 under stress remain unknown. In this investigation, we screened and confirmed that forkhead box protein O3 (FOXO3) participates in MFN2's expression during short periods of starvation. Luciferase reporter test proved that FOXO3 facilitates MFN2's transcription by binding to its promoter region, and FOXO3 downregulation directly depresses MFN2's expression. Consequently, inhibiting the FOXO3-MFN2 axis results in the loss of mitochondrial fusion, disrupting the normal morphology of mitochondria, impairing the degradation of substrates, and reducing autophagosome accumulation, ultimately leading to the blockage of the autophagy. In conclusion, our work demonstrates that the FOXO3-MFN2 pathway is essential for adaptive changes in mitochondrial morphology and cellular autophagy response under nutritional constraints.

The Type III secretion effectors (T3SEs) are bacterial proteins synthesized by Gram-negative pathogens and delivered into host cells via the Type III secretion system (T3SS). These effectors usually play a pivotal role in the interactions between bacteria and hosts. Hence, the precise identification of T3SEs aids researchers in exploring the pathogenic mechanisms of bacterial infections. Since the diversity and complexity of T3SE sequences often make traditional experimental methods time-consuming, it is imperative to explore more efficient and convenient computational approaches for T3SE prediction. Inspired by the promising potential exhibited by pre-trained language models in protein recognition tasks, we proposed a method called PLM-T3SE that utilizes protein language models (PLMs) for effective recognition of T3SEs. First, we utilized PLM embeddings and evolutionary features from the position-specific scoring matrix (PSSM) profiles to transform protein sequences into fixed-length vectors for model training. Second, we employed the extreme gradient boosting (XGBoost) algorithm to rank these features based on their importance. Finally, a MLP neural network model was used to predict T3SEs based on the selected optimal feature set. Experimental results from the cross-validation and independent test demonstrated that our model exhibited superior performance compared to the existing models. Specifically, our model achieved an accuracy of 98.1%, which is 1.8%-42.4% higher than the state-of-the-art predictors based on the same independent data set test. These findings highlight the superiority of the PLM-T3SE and the remarkable characterization ability of PLM embeddings for T3SE prediction.