Voprosy pitaniia最新文献

The importance of proper nutrition when playing sports is difficult to overestimate. Athletes of any age need to consume a sufficient amount of macro- and micronutrients for bone health. High-quality and balanced nutrition in terms of quantity and composition is important for optimal recovery after training, adaptation to intense physical activity and prevention of sports injuries. The aim of the study was to summarize the current data of domestic and foreign literature on the factors affecting bone mineral density (BMD) in athletes, as well as to consider the key points of nutritional support necessary for the prevention and treatment of osteoporosis. Material and methods. The search was conducted using the Google Academy search engine and electronic databases PubMed, MEDLINE, EMBASE, Scopus, Web of Science, eLIBRARY for the period from 2008 to 2022. For the search, we used keywords and their combinations: "athletes", "osteoporosis", "stress fractures", "calcium" and "vitamin D". Results and discussion. Bone health is influenced by many factors, the most significant of which are lifestyle and the nature of a person's physical activity. Despite strong evidence for the benefits of exercise for bone health, there are sports that predispose to low BMD and increase the risk of osteoporosis. First of all, athletes involved in aerobic and aesthetic disciplines (long-distance running, cycling, swimming, rhythmic gymnastics, dancing, etc.) are at risk. In addition, factors that predispose to a decrease in BMD include female gender, low intake of energy substrates, protein, vitamin D and calcium, and certain medications. Of great importance for the regulation of bone metabolism and maintaining optimal BMD are the genetic characteristics of the athlete. The main adverse consequences for athletes with reduced BMD are fractures of various localization. At the same time, the problem of a high risk of developing stress injuries of bones is especially relevant. Calcium and vitamin D are key nutritional factors needed to maintain bone health. Optimal intake of carbohydrates, proteins, and polyunsaturated fatty acids is also important. There is evidence of a positive effect on the skeletal system of such nutritional factors as potassium, magnesium, sodium, vitamins K, C, B12 and folic acid. The specific mechanisms of the influence of these micronutrients on bone metabolism and the relationship of their consumption level with BMD need further research. Conclusion. Thus, athletes of all ages and specializations need to pay great attention to the state of the skeletal system. Given the association between the risk of osteoporosis and malnutrition, it is essential for athletes to maintain an optimal nutritional status and consume adequate amounts of vitamins and minerals.

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

Amaranth (Amaranthus L.), like other pseudocereals as quinoa (Chenopodium quinoa Willd.), chia (Salvia hispanica L.) and buckwheat (Fagopyrum sp.), is a promising source of dietary protein. Depending on the subspecies and breeds of amaranth, the protein content in its grain is estimated from 13.1 to 21.5%, and its amino acid score varies over a significant range and can be limited. The aim of this study was to obtain a protein concentrate from amaranth (Amaranthus L.) grain of the Voronezh breed, enrich it with chicken egg protein, determine the amino acid score of the obtained protein module, and experimentally evaluate in vivo its true digestibility and biological value. Material and methods. The amaranth protein concentrate was obtained from grain according to the technological scheme, including its enzymatic treatment, alkaline extraction, acid precipitation of proteins, microfiltration and lyophilization. The amino acid composition and amino acid score of the concentrate were determined. The protein module was obtained by mixing amaranth protein concentrate and chicken egg protein in a weight ratio of 58:42. The true digestibility and biological value of the protein module has been determined in vivo. The experiment was carried out on 32 Wistar male rats divided into 2 groups (n=16 rats): control group 1 with a body weight of 118.7±3.1 g and experimental group 2 with a body weight of 119.5±3.0 g. Animals of groups 1 and 2 received diets in which egg protein and a protein module were used as a protein source, respectively. Within 15 days of the experiment, individual indicators of food intake and body weight gain of each animal were determined. From the 14th to the 15th day food intake was determined and feces were collected. The amount of nitrogen in the food and feces was determined for each rat using the Kjeldahl method. The true digestibility of the protein was determined according to obtained data. Results. The resulting amaranth protein concentrate contained 70.4±0.6% of protein, 17.0±1.0% fat, 9.8±0.8% carbohydrates, 1.8±0.2% ash, its moisture content was 1.4±0.1%. There were no significant differences in food intake and body weight gain between animals of both groups. The calculated value of the true digestibility of chicken egg protein was 98.8±0.1% for the control group 1, of the protein module was 99.0±0.1% for the experimental group 2, the differences between the groups were not significant. Conclusion. The results of amino acid analysis and the in vivo study of the true digestibility of the protein module (composition amaranth protein/chicken egg protein) indicate the absence of limitation relative to the amino acid scale of the "ideal" protein (FAO/WHO, 2007) and high true digestibility. The biological value of the protein module, calculated according to PDCAAS, is 99.0±0.1%, which confirms the prospects for its inclusion in specialized foods.

Despite the fact that dietary supplements (DS) are not medicines, an increasing number of publications testify to the effectiveness of probiotics consumed with food in the complex treatment and prevention of a number of diseases of the gastrointestinal tract, including irritable bowel syndrome (IBS) and antibiotic-associated diarrhea (AAD). The purpose of the study was to evaluate the effectiveness of the complex probiotic in the relief of diarrheal syndrome associated with intestinal microbiota dysbiosis in patients with IBS with diarrhea and AAD. Material and methods. The study included 54 patients (31 with IBS with diarrhea and 23 with idiopathic AAD) aged 18 to 50 years. All patients included in the study were prescribed 1 capsule (350 mg) of the DS Neobiotic Lactobalance® per day for 21 days. One capsule contains: bifidobacteria (Bifidobacterium longum CBT BG7, Bifidobacterium lactis CBT BL3 Bifidobacterium bifidum CBT BF3), lactobacilli (Lactobacillus acidophilus CBT LA1, Lactobacillus rhamnosus CBT LR5), lactic acid bacteria (Streptococcus thermophilus CBT ST3), fructooligosaccharides, vitamin C. The daily intake of bifidobacteria was 8.7×10⁸ CFU, lactobacilli - 6.1×10⁹ CFU, lactic acid bacteria 3.1×10⁸ CFU and vitamin C - 12 mg. The severity of symptoms was assessed in points (from 0 to 7 points) using the GSRS questionnaire (Gastrointestinal Symptom Rating Scale). All patients underwent a microbiological analysis of feces with an assessment of the degree of dysbiosis before and after the administration of DS. Results. In patients with IBS with diarrhea, the assessment of the manifestations of diarrheal syndrome according to the GSRS questionnaire decreased statistically significantly from 17 to 6 points (2.9 times), abdominal pain - from 12 to 4 points (3.0 times) and dyspeptic syndrome - from 8 to 3 points (in 2.7 times). In patients with AAD, also according to the GSRS questionnaire, the manifestations of diarrheal syndrome decreased statistically significantly from 13 to 3 points (4.3 times), abdominal pain - from 4 to 1 points (4.0 times) and dyspepsia syndrome - from 5 to 2 points (in 2.5 times). Against the background of DS intake, according to the data of bacteriological examination of feces, intestinal microbiota normalized by day 21 due to an increase in the number of lacto- and bifidobacteria (p=<0.05). Conclusion. The study showed that the DS Neobiotic Lactobalance® contributes to the normalization of the intestinal microbiota and reduces the severity of clinical manifestations (diarrheal disorders or manifestations of diarrhea) in IBS and idiopathic AAD.

An updated consensus statement from the European Menopause and Andropause Society noted that a woman's quality of life may decline during peri- and post-menopause as a result of various menopausal symptoms and age-related comorbidities. The purpose of the work was to assess the possibility of using bioactive compounds in periand postmenopausal women to prevent the development of menopausal complications and chronic diseases associated with aging. Material and methods. Literature search was carried out using PubMed, Google Scholar, ResearchGate, RSCI databases mainly over the past 10 years, with the exception of works of fundamental importance, according to the keywords "perimenopause", "postmenopause", "Affron® saffron extract", "special extract ERr 731". Results. The use of diet, dietary supplements including those containing extracts of saffron (Affron®) and Siberian rhubarb (ERr 731) and their biologically active substances, has a versatile effect on the correction of menopausal disorders due to the impact on various pathogenetic pathways of their development and can be used in women in this period as a phytonutrient support. Conclusion. The combined use of saffron and Siberian rhubarb extracts is promising from the point of view of correcting the female state during peri- and postmenopause, taking into account the pathogenetic moments of the development of menopausal complications and chronic diseases associated with aging.

Nutrition in sports, as a branch of nutritional science, is a constantly developing field with a growing number of scientific researches and recommendations concerning the justification of the diet composition to ensure the requirements for macro- and micronutrients of the athlete's body at different stages of sports activity and energy value, as well as the use of special dietary supplements of various nature, including protein in forms of specialized dry mixes, drinks, etc. The aim of the research was to present the results of studies conducted abroad, presented in review publications and original articles, on the role of protein and the impact of its various levels of consumption on the maintenance of muscle mass as a criterion for the effectiveness of diets used, including in conditions of their reduced calorie content; on the safety of consuming significantly higher than recommended amounts of protein (>2.0 g/kg of body weight per day); about the relationship between protein dose and the possible increase in lean body mass. Material and methods. For the main source search, the PubMed Internet resource was used, and the websites of the Springer and Elsevier publishers were used to access the full text of the articles. Search depth 10 years. Results. This review presents the official position of the International Society of Sports Nutrition (ISSN) on the role of protein in training optimization, body composition change and improving the performance of athletes. Generalized data on the body's energy costs for the assimilation of nutrients, food thermogenesis and the importance of protein for maintaining resting energy expenditure are presented. Published results based on meta-analyses support the efficacy of higher protein intake in reducing body weight and fat mass while maintaining lean mass in an energy-deficient setting. The anabolic properties of protein under conditions of increased physical exertion will manifest themselves only with sufficient energy and protein supply. The proposed values and boundaries within which increased protein intake effectively affect body composition in the process of adaptation to strength training are given. It has been shown that an increase in protein intake above the average maximum values practically does not lead to an increase in lean body mass without the simultaneous introduction of additional resistance exercises that restores its growth. In accordance with the official position of the ISSN, the recommended protein intake corresponds to values from 1.4 to 2.0 g/kg of body weight per day for individuals performing various special sets of physical exercises. The use of high-protein diets (protein >2.0 g/kg/day) in highly qualified athletes who do not have kidney and liver diseases showed no changes in the biochemical parameters of blood and bone mineral density confirming its safety. Conclusion. Based on the analysis of scientific data, it can be stated that proteins

Assessment of public health safety associated with chemical contaminants consumed with food is an important component for solving the tasks of ensuring the sanitary and epidemiological well-being of the population. For these purposes, it is necessary to establish priority potentially dangerous compounds among the identified undeclared and unintended chemical contaminants for further consumers risk assessment. In conditions of unacceptable levels of health risk, it is necessary to decide whether it is advisable to develop new or change existing hygiene standards for these substances. The aim of the study was to assess the health risk associated with priority potentially dangerous unintended chemical components of contamination in canned meat and meat-and-vegetable products for infants (using the example of N-nitrosoamines). Material and methods. The selection of priority chemical compounds and public health risk assessment were carried out in accordance with the procedure for identifying undeclared and potentially dangerous unintended chemicals in food and using modified approaches based on the results of previous studies. Health risk assessment for infants consuming canned meat and meat-and-vegetables containing priority chemicals was carried out in accordance with the methodology approved by the Eurasian Economic Commitee, as well as using the Guidelines for assessing risks to public health when exposed to environmental pollutants. To characterize the calculated risk levels, the classification proposed in the draft document «Guidelines for assessing risks to public health when exposed to environmental pollutants» was used. Results. N-nitrosoamines are classified as chemical contaminants that are a priority for public health risk assessment, identified on the basis of the potential hazard category. A comparative health risk assessment for the target group consumers of canned meat and meat-and-vegetables sold on the territory of the Russian Federation and the Socialistic Republic of Vietnam showed the presence of an unacceptable risk to the health of the Russian population in relation to non-carcinogenic adverse health effects associated with the intake of N-nitrosodimethylamine (NDMA) (hazard quotient HQ=1.1) and N-nitrosodibuthylamine (HQ=5.25). Many experimental (animal) researches confirm the formation of negative effects and potential harm to humans, formed by the consumption of N-nitrosoamines with food. At the same time, the level of the exposure of N-nitrosoamines during oral administration was assessed mainly from the side of carcinogenic effects, however, this study reflects the hazard, including from non-carcinogenic risks associated not only with NDMA and N-nitrosodiethylamine, for which there is a hygienic standard, but also for other N-nitrosoamines, for which there is no hygienic regulation. In turn, the European Food Safety Agency's (EFSA) study notes that it is necessary to conduct a risk assessment for

A large number of socio-economic factors affect the nutritional status of an athlete. Athletes' nutritional awareness can affect longterm health and occupational disease risks among athletes. To assess the level of knowledge of athletes about nutrition, scientists of the world community have developed various types of tools in the form of questionnaires that are successfully used in practice to analyze the nutrition of athletes and optimize it. However, existing questionnaires and forms for filling them out have certain disadvantages, the most significant of which is a large number of questions, which requires significant time expenditure for athletes. The goal of the research was to develop a questionnaire for conducting a survey of athletes using the classical theory of testing and the principles of The nutrition for sport knowledge questionnaire (NSKQ). Based on the results of the survey, an assessment was made of the hypothesis about the influence of the basic knowledge of athletes in matters of nutrition on the correctness of their answers within the questionnaire. The developed survey tool was also validated to ensure its reliability. Material and methods. To obtain general information about the target audience and identify the level of knowledge of athletes about nutrition, a questionnaire was developed, which subsequently went through several stages of verification and validation. The respondents were athletes from the "Kronverkskie Barsy" student sports club at ITMO University. At the first stage of developing the questionnaire, questions were prepared about the target audience (TA) and blocks of questions about the basic knowledge of the TA on the main macronutrients of food, in particular on the blocks "proteins" (P), "fats" (F) and "carbohydrates" (C). At the second stage of the work, an online format for surveying respondents in a Google Form was implemented with a maximum time for completing the survey no more than 15 minutes. At the third stage of the study, the results of the survey were evaluated with preliminary data coding based on the Jamovi program. As a result, the analysis of the proposed hypotheses and the evaluation of the obtained research data were carried out. Results. This study involved 56 athletes, of which 59% were women and 41% were men, average age 20.8±4.9 years. Most of the survey participants were ITMO University students (87.5%). 60.7% were involved in sports at a professional level, 35.7% - at an amateur level, and 3.6% of respondents belonged to elite sports. The average body mass index of the respondents (20.6±4.8 kg/m2) corresponded to the norm according to the Regulations of the World Health Organization. During the survey, the majority of respondents (78.6%) reported that they had basic knowledge on nutrition, a smaller part of the respondents - 12 (21.42%) people did not have basic knowledge about nutrition. It was suggested that there were significant differences in the corr

The current practice of novel food safety assessment in the Russian Federation involves toxicological studies on the alimentary model of adaptation potential reduction of laboratory animals. Since vitamin and mineral deficiency can affect the size of structural elements of tissues, an objective estimation of the results obtained using this model is possible when determining the range of fluctuations of the studied morphometric parameters under conditions of different essential substances' supply, as well as under conditions of simulated toxic effects on the background of the corresponding supply. The purpose of the research was to investigate the morphological and morphometric features of the liver under the influence of reduced intake of vitamins and mineral elements in the combination with toxic effects of various nature, during growth and puberty of male Wistar rats. Material and methods. The article analyzed data of 4 model experiments on 140 animals that received semi-synthetic casein diet with different supply of vitamins B1, B2, B3, B6 and mineral elements Fe³⁺ and Mg²⁺, as well as data of 2 experiments on 180 animals with simulated toxic load of cadmium (Cd²⁺) salts and carbon tetrachloride. The animals were ~95 days old at the time of sampling, the duration of the experiments was ~65 days. For the analysis we used data on rats' body weight on the day of material sampling, absolute and relative liver weight, hepatocyte diameter, nucleus diameter and hepatocyte cytoplasm size in the central and peripheral zones of hepatic lobules. A total of 200 cells were analyzed in each group of animals. In accordance with the study design, all quantitative traits of the groups that received diets with an essential nutrient supply ranging from 75 to 2% were compared with the group that received a complete diet (100%). Results. Morphometric examination of hepatocytes revealed a linear decrease in the size of cell structural elements in the series of reducing the content of essential micronutrients in the diet. Under the conditions of 2-4% vitamin and mineral supply, cell and nucleus diameters as well as cytoplasm size were by ~16.8, 12.6 and 21.1% (p<0.05) lower respectively than in rats with optimal supply of these substances; under the conditions of 9-19% supply were by ~9.2, 9.7 and 8.7% lower (p<0.05); higher levels of supply caused reduction of hepatocyte, nucleus and cytoplasm sizes in a range not exceeding 5% (p>0.05). When comparing the size of hepatocytes of rats subjected to toxic load with the hepatocytes of rats referred to the reference standard, an increase in the size of hepatocytes under the action of carbon tetrachloride by 17.4% (p<0.05) on average and under the action of cadmium salts by 4.6% (p<0.05) was noted. Conclusion. Based on the analysis of liver morphological and morphometric studies' data, there were established sizes of hepatocytes structural elements in the

The food diversity is a significant indicator of a healthy diet. The aim of the study was to assess the indicators of food diversity in the metropolis (Moscow) based on the analysis of consumer activity in a large retail chain. Material and methods. 201 904 holders of loyalty cards of the retail network were selected from the depersonalized purchase data for 2016-2018 according to the following selection criteria: the presence of a dense segment of purchases (more than 4 weeks, where there was at least 1 purchase in 2 weeks), where the total cost of purchases was at least 4700 rubles and at least 4 different products were purchased. From of these, 111 136 buyers have data available by gender, 43 046 by age. The classification of a set of purchased products and dishes by food groups was carried out, and complex dishes were transformed into a set of their ingredients and the distribution of the unique values of the corresponding food groups was carried out. Counting the number of unique preferences (count base diversity) by the number of positions in each of the 6 food groups (cereals, fish and meat, fat products, dairy products, vegetables, fruits and berries) allowed us to estimate the amount of food diversity. The total number of food categories in all subgroups was also calculated. Results. The low value of food diversity in the category of cereals and cereals was found in 2/3 of buyers, in the category of vegetables and fruits in 60% of buyers, in the category of meat and fish products in half of buyers, in the category of fat-and-oil products in 63.7% and in 44.2% of buyers of dairy products. An acceptable total number of categories of purchased products (more than 20 per week) was achieved only in 14.5% of men and 16.7% of women from our sample. In general, lower indicators of dietary diversity are typical for men and young people (up to 45 years old). Conclusion. Thus, it can be concluded that the importance of food diversity as a factor of health protection is underestimated by the population, especially by young people, which can lead to an increase in the burden on healthcare due to the earlier debut of a wide range of chronic diseases.