Journal of Extracellular Vesicles最新文献

The development of technologies for screening proteins that bind to specific tissues in vivo and facilitate delivery of large cargos remains challenging, with most approaches limited to cell culture systems that often yield clinically irrelevant hits. To overcome this limitation, we developed a novel molecular screening platform using an extracellular vesicle (EV) display library. EVs are natural molecular carriers capable of delivering diverse cargos, which can be engineered to enhance specificity and targeting through surface modifications. We constructed an EV-display library presenting monobody repertoires on EV surfaces, with genetic cargo inside the EVs corresponding to the displayed proteins. These libraries were screened for tissue specific delivery through serial passage in mice via sequential intravenous administration in and recovery of tissue-selected EVs and amplification of their encapsulated monobody genes at each passage. Our results demonstrated successful selection of tissue-specific targeting proteins, as revealed by fluorescence and bioluminescence imaging followed by DNA sequencing. To understand the stochastic relationship between displayed proteins and packaged genes, we developed a mathematical analysis that revealed the complex selection dynamics and demonstrated successful enrichment despite the imperfect correlation between phenotype and genotype. This EV-based monobody screening approach, combined with mathematical modelling, is a significant advancement in targeted drug delivery by leveraging the natural capabilities of EVs with the selection of targeting proteins in a physiologically relevant environment.

HIV-associated neurocognitive disorders (HAND) affect 30%–50% of individuals living with HIV on combination antiretroviral therapy, with Alzheimer ’s-like pathology as a potent comorbidity of HAND. Our previous studies have implicated hypoxia-inducible factor-1 alpha (HIF-1α) as a central regulator of HIV-1 Tat-mediated amyloid production in astrocytes, which are further released via astrocyte-derived extracellular vesicles (ADEVs), inducing synaptodendritic injury and Alzheimer's-like pathology in naive mice. Based on this premise, we hypothesized that ADEVs carrying HIF-1α-targeting small interfering RNA (siRNA) would alleviate HIV-1-induced Alzheimer's-like pathology and neurodegeneration in CD34+ NSG HIV-infected humanized mice. Intranasally administered mCherry-TSG101-tagged ADEVs in mice demonstrated efficacy of brain delivery, especially to the hippocampus and cortex. In CD34+ NSG mice infected with HIV-1, intranasal delivery of HIF-1α siRNA-loaded ADEVs suppressed HIF-1α, reduced amyloid precursor protein (APP), AβmoC64, Aβ fibrils, and hyperphosphorylated tau (pTau), dampened glial activation as indicated by reduced GFAP and IBA1 expression, and partially restored synaptic proteins, which were dysregulated due to HIV-1 infection. Trends of improvement were also observed in behavioural deficits in spatial memory, anxiety-like behaviour, and sensorimotor gating induced by HIV-1. These findings position HIF-1α as a pivotal mediator of HIV-associated Alzheimer's-like pathology and neurodegeneration in the CD34+ NSG mice and underscore the promising role of ADEV-mediated HIF-1α siRNA delivery as a non-invasive therapeutic strategy for HAND.

Retinal neovascular diseases are leading causes of global blindness. Migrasomes, organelles released during cell migration, play a role in intercellular communication and are present in M2 macrophages, which are critical to the pathology of retinal neovascular diseases. This study investigates the involvement of M2 macrophage-derived migrasomes in ischaemia-induced retinal neovascularization (RNV). Migrasomes are isolated from macrophages and characterized by Western blotting and transmission electron microscopy. Compared with controls, M2 macrophage-derived migrasomes significantly enhance human retinal microvascular endothelial cell (HREC) functions by Cell Counting Kit-8, transwell, and tube formation assays, and markedly contribute to the pathological retinal angiogenesis of oxygen-induced retinopathy (OIR) mice. Triggering receptor expressed on myeloid cells 2 (TREM2) is selected as the potential downstream target of M2 macrophage-derived migrasomes by proteomic analysis. Moreover, the depletion of M2 macrophages in OIR retinas reduces the levels of migrasomes and TREM2. BTC and PLA1A overexpression in HRECs could attenuate decreased HREC functions induced by sh-TREM2 M2 macrophage-derived migrasomes. These findings demonstrate that TREM2-enriched M2 macrophage-derived migrasomes contribute to pathological RNV in vivo and positively regulate HREC functions in vitro through targeting TREM2-BTC/PLA1A, which may serve as biomarkers and therapeutic targets for retinal neovascular diseases.

Grisard E., N. Nevo, A. Lescure, et al. (2022). Homosalate Boosts the Release of Tumour-Derived Extracellular Vesicles With Protection Against Anchorage-Loss Property. Journal of Extracellular Vesicles, 11, e12242. https://doi.org/10.1002/jev2.12242

In paragraph “4.2 Plasmids” of the “Materials and Methods” section, several typos and errors were inserted in the description of the NLuc-CD9 plasmid construction steps: (1) the indicated primer sequences corresponded to the DNA sequence of CD9 (with one base missing) rather than the actual primers in forward or reverse order with the additional restriction enzyme sequences; (2) the addgene reference of the GFP-HSP70 construct was missing one digit; (3) the enzyme used to excise GFP from this construct was mistakenly indicated as SpeI instead of AgeI. Consequently, instead of:

Nluc-CD9 construct was obtained as follows: CD9 sequence was first PCR-derived from tdTomato-CD9-10 construct (kind gift of Michael Davidson) using the indicated primers (Forward: CTCAAGCTTCCCCGGTCAAAGGAGGCA; Reverse: ATCCGCAGGAACCGCGAGATGGTCTAG). Then, a Renilla-luciferase-HSP70 construct previously obtained in our laboratory by removing GFP sequence from GFP-HSP70 construct (Addgene, #1525) with XhoI and SpeI restriction enzymes (New England Biolabs) was used as intermediate. Briefly, HSP70 sequence was removed from Renilla-luciferase-HSP70 and was replaced by CD9 sequence using XhoI and SpeI restriction enzymes. Finally, Renilla-luciferase sequence was removed using AgeI and XhoI restriction enzymes and was replaced by Nluc sequence using the same enzymes.

The right description should have been:

Nluc-CD9 construct was obtained as follows: CD9 sequence was first PCR-derived from tdTomato-CD9-10 construct (kind gift of Michael Davidson) using the indicated primers (Forward: ATTCTCGAGCTCAAGCTTCCACCGGTCAAAGGAGGCA; Reverse: ATTACTAGTCTAGACCATCTCGCGGTTCCTGCGGAT). Then, a Renilla-luciferase-HSP70 construct previously obtained in our laboratory by removing GFP sequence from GFP-HSP70 construct (Addgene, #15215) with AgeI and XhoI restriction enzymes (New England Biolabs) was used as intermediate. Briefly, HSP70 sequence was removed from Renilla-luciferase-HSP70 and was replaced by CD9 sequence using XhoI and SpeI restriction enzymes. Finally, Renilla-luciferase sequence was removed using AgeI and XhoI restriction enzymes and was replaced by Nluc sequence using the same enzymes.

We apologise for these errors.

Pediatric diffuse midline gliomas with the Histone 3 lysine 27-to-methionine mutation (H3K27M-pDMG) are aggressive brain tumors characterized by intrinsic resistance to radiation therapy, the current standard of care. These tumors exhibit significant intratumoral heterogeneity, with distinct subclonal populations likely contributing to therapy resistance. Emerging evidence suggests that small extracellular vesicles (sEV) mediate oncogenic signaling within glioma stem cell populations, yet their role under radiation-induced stress remains poorly understood. In this study, we characterized sEV uptake dynamics among H3K27M-pDMG tumor cells, identified key sEV surface proteins, and demonstrated that sEVs derived from radioresistant (RR) H3K27M-pDMG cells confer radioprotective effects on radiosensitive tumor cells. Molecular profiling revealed that RR-sEVs carry proteins, microRNAs (miRNAs) and metabolites associated with glycolysis, oxidative phosphorylation and DNA repair. Upon uptake, RR-sEVs reprogrammed recipient cells by altering gene expression and metabolic pathways, and enhancing DNA repair and survival following radiation exposure. These findings provide insights into the role of sEV-mediated intratumoral communication as a contributor to radiation resistance in H3K27M-pDMG and suggest potential therapeutic strategies to disrupt this process and enhance radiation efficacy.

Tumour-derived extracellular vesicles (TEVs) play a crucial role in cancer progression, metastasis and therapy resistance but their distinct profiles across different cancer stages and molecular subtypes remain underexplored. This study initially analysed TEVs from all CMS subtypes in colorectal cancer (CRC) cells and continued focusing on the epithelial (CMS2) and mesenchymal (CMS4) subtypes using six cell lines and clinical samples. Investigation of the cargo of vesicles secreted by the two subtypes revealed significant differences in mRNA, miRNA, and protein profiles between the two subtypes. Notably, CMS2 predominantly secreted smaller, Tetraspanin-8 (TSPAN8) enriched EVs, while CMS4 produced both larger and smaller EVs, enriched in TSPAN4. This underscores the complexity of vesicle heterogeneity between these subtypes. Additionally, we assessed miRNA profiles from plasma-derived bulk TEVs in CRC patients. Our integrative analysis identified a subtype-specific miRNA signature, indicating that TEVs from CMS2 and CMS4 cells can be detected in circulation and may serve as potential diagnostic tool for CRC.

Extracellular vesicles (EVs) are biological nanovectors that retain molecular signatures of their cells of origin and mediate intercellular communication, resulting in ideal platforms for the development of diagnostic tools and bio-inspired drug delivery technologies. Despite their potential, the mechanisms underlying EV release, uptake and distribution remain unclear. Here, we leverage high-resolution live-cell imaging, quantitative analytical methods and in vivo mouse models to define the major determinants of EV diffusion. Our findings reveal that cell density plays a crucial role in EV dissemination. Specifically, sparsely distributed cells exhibit higher EV release rates into the supernatant due to increased surface exposure in vitro. In contrast, densely packed cells promote EV internalization and degradation by adjacent cells, effectively restricting EV diffusion in vivo and in vitro. As a result, EVs travel only limited distances, with the majority being internalized by adjacent cells. These findings challenge the prevailing assumption that any EV can act as long-range messengers and instead highlight their function as short-range communication agents primarily confined within their tissue or organ of origin. This study provides fundamental insights into EV-mediated intercellular signalling and has important implications for their use in diagnostic and therapeutic applications.

Extracellular vesicles (EVs) are critical mediators of intercellular communication within the tumour microenvironment and play a significant role in drug resistance. We aimed to investigate the mechanisms underlying gemcitabine (GCB) resistance in bladder cancer. GCB-resistant bladder cancer cells exhibited dysregulation of nucleoside-metabolizing enzymes and transporters. Characterization of EV subpopulations derived from GCB-resistant cells revealed their ability to transfer drug-resistant phenotypes to naïve cancer cells by modulating intracellular levels of nucleoside metabolic proteins and transporters. Proteomic and transcriptomic analyses identified the histone protein H3.2 and its corresponding transcript, H3C14, as key regulators in the transmission of GCB resistance. Notably, H3C14 overexpression in resistant cells restored GCB sensitivity, whereas its knockdown induced GCB resistance. Rab27A-mediated biogenesis and secretion emerged as a crucial mechanism regulating EV release and H3C14 excretion in GCB-resistant cells. A specific EV subpopulation enriched in CD147 and LAMB1—referred to as Excretion EVs—carried H3.2 (H3C14) but did not induce GCB resistance in recipient cells, suggesting their primary role in eliminating proteins associated with tumour progression and drug resistance. These findings highlight the role of EV-mediated H3C14 excretion in regulating GCB resistance and suggest potential therapeutic strategies targeting EV pathways to overcome drug resistance in bladder cancer.

With a membership of nearly 2000 individuals spanning the globe, the International Society for Extracellular Vesicles (ISEV) stands as the premier professional organization for scientists and researchers engaged in the exploration of extracellular vesicles (EVs). Established in 2012 in Sweden, ISEV subsequently relocated its headquarters to New Jersey, USA. ISEV is dedicated to fostering global consistency and robustness in EV research, as underscored by the MISEV guidelines of 2014 and 2018 and the update in 2023. The society facilitates this mission through an array of initiatives, including educational offerings, task forces, special interest groups, workshops, and summer schools, while also managing two peer-reviewed, gold open access journals—the Journal of Extracellular Vesicles and the Journal of Extracellular Biology. A cornerstone of ISEV's activities is its flagship annual gathering, a focal point that provides a crucial avenue for knowledge exchange. By means of its comprehensive programmes and services, ISEV plays an indispensable role in delivering vital training and research prospects for those immersed in the realm of EV research.

The International Society for Extracellular Vesicles is the premier international conference of extracellular vesicle research, covering the latest in exosomes, microvesicles and more. With more than 1500 attendees, the meeting has achieved a new level of recognition in the global community and features presentations from the top researchers in the field, as well as providing opportunities for talks from students and early-career researchers.

IOC Chairs: Eva Rohde (Austria), Eva-Maria Krämer-Albers (Germany)

IOC Members: An Hendrix (Belgium), Andreas Moeller (China), Bo Li (China), Edit Buzas (Hungary), Johannes Grillari (Austria), Lucia Languino (USA), Mario Gimona (Austria), Sun Young Lee (USA), Wolf Holnthoner (Austria), Cristóbal Cerda-Troncoso (Belgium), Madhusudhan Bobbili (Austria).

Plenary Presenter: Nicole Meisner-Kober

Ludwig Boltzmann Institute for Nanovesicular Precision Medicine, Vienna, Austria

Presenter: Shili Yao

Tianjin University, Tianjin, China

Introduction: The advent of HER2-targeted antibody drug conjugates (HER2-ADCs) has marked a revolutionary advancement in targeted breast cancer therapy. However, 60%–70% of patients who are completely HER2 negative and do not meet the HER2-low criterion are unable to benefit from these treatments. Engineered extracellular vesicles (EVs), which are naturally occurring nanocarriers, possess the distinctive attributes of high biocompatibility and low immunogenicity. This study aims to utilize engineered EVs to facilitate the continuous and safe presentation of the HER2 antigen to breast tumour cell membranes via membrane fusion, thereby exploring the potential for enhancing HER2-ADCs' efficacy.

Methods: Firstly, magnetic bead-assisted high-speed dispersion technology was employed

Extracellular vesicles (EVs) have been investigated as nanotherapeutics and drug delivery systems for a wide range of disease indications. However, translational application of EVs is challenging due to their physical heterogeneity and variation in functional potency. The current study generated a novel hybrid EV formulation by membrane fusion of mesenchymal stem/stromal cell-derived EVs with astrocyte-derived EVs and defined its physicochemical and functional properties. Both EV populations have translational potential for neurodegenerative disease applications—a disease area with limited treatment strategies due to its complex disease biology requiring multi-faceted therapeutic approaches. However, individual EV sources lack the full set of therapeutic properties needed for comprehensive treatment. Stem cell-derived EVs possess general neuroprotective and anti-inflammatory effects but lack widespread blood–brain barrier penetration and specific neurodegenerative pathology targeting. Astrocytes are uniquely involved in key neuronal processes but are prone to adopting neuroinflammatory phenotypes in disease states. Using super resolution microscopy and quantitative proteomic analysis, we characterized, optimized, and validated a hybrid EV formulation for its brain cell targeting, neuroprotective function, and immunomodulatory capability. These results establish a platform for EV engineering through EV-EV hybridization and demonstrate the potential of one formulation for neurodegenerative applications.