Journal of Extracellular Vesicles最新文献

Intercellular communication is essential for healthy embryo development, yet the role and dynamics of extracellular space in the maternal-embryonic dialogue remain unclear. Furthermore, little is known of maternal and embryonic metabolic states during early endometrial preparation and after the embryo enters the uterine cavity. Using a human in vitro co-culture model and extracellular vesicle (EV)-specific tools, we dynamically tracked EV secretion, uptake and processing between embryonic and endometrial cells at early stages of cell-to-cell communication. Hormonal stimulation altered endometrial secretory output, producing distinct EV populations. Stimulated EVs (St-EVs) differed from non-stimulated EVs (NSt-EVs) in size, secretion dynamics, uptake efficiency and metabolic cargo, selectively packaging energy-related metabolites and aryl hydrocarbon receptor (AhR) ligands. AhR inhibition increased spheroid attachment, suggesting that AhR signalling regulates implantation by modulating the endometrial environment. Additionally, lipid droplets (LDs) affected by endometrial- and embryo-derived EVs were actively secreted and taken up by embryonic cells, highlighting their role in implantation. EVs were not only exchanged between the embryo and endometrium but were also rapidly internalized, influencing mitochondrial activity, lipid metabolism and extracellular matrix remodelling. Translation of EV-derived mRNA occurred within 1 h of uptake, driving cellular changes and enhancing embryo attachment. These findings suggest EVs, extracellular metabolites and LDs mobilized between the endometrium and embryo coordinate to promote embryo attachment and implantation. This study advances our understanding of embryo-maternal EV-mediated communication and provides a valuable model for investigating EV-mediated simultaneous intercellular bidirectional crosstalk in other biological contexts.

The emergence and worldwide dissemination of antibiotic resistance genes (ARGs) compromise antibiotic therapy and are a major public health crisis. Horizontal gene transfer (HGT) plays a major role in the spread of ARGs among bacterial pathogens. Outer membrane vesicles (OMVs), which are membrane-bound particles and naturally released by Gram-negative bacteria, have been reported to carry a variety of cargos such as DNA, proteins and lipids. However, it remains unknown whether OMVs mediate transfer of ARGs in Campylobacter, an important foodborne pathogen whose resistance to antibiotics poses a serious threat to public health. To close this knowledge gap, we determined the role of OMVs in ARG transfer. Using a non-conjugative plasmid (pRY112), we demonstrated that OMVs successfully transferred the plasmid from Campylobacter coli to Campylobacter jejuni. Additionally, OMVs transferred chromosomally encoded florfenicol resistance from a clinical C. coli isolate (SH89) to C. jejuni. The OMV-mediated transfer is independent of natural transformation as both DNase I treatment (for digestion of external-free DNA) and use of a strain deficient of natural transformation as the recipient strain did not affect OMV-mediated ARG transfer. Transmission electron microscopy revealed direct fusion between OMVs and recipient bacterial membranes, suggesting membrane fusion as the mechanism for OMV-mediated DNA transfer. Furthermore, we showed that OMVs derived from strains expressing a functionally-enhanced CmeB (FE-CmeB) transiently protect florfenicol-susceptible C. jejuni against selection by the antibiotic. Together, these findings indicate that OMVs mediate the transfer of both plasmid- and chromosome-encoded ARGs in Campylobacter and define OMVs as a novel pathway for Campylobacter to acquire antibiotic resistance via HGT.

According to the endosymbiotic theory of mitochondrial origin, an α-proteobacterium entered a prokaryotic cell and, through symbiosis, evolved into the mitochondria—the powerhouse of the cell. Like other bacteria, the α-proteobacteria generate their own extracellular vesicles (EVs), a trait that was passed onto the mitochondria, enabling them to generate mitochondria-derived vesicles (MDVs). MDVs, similar to small EVs (sEVs), are vesicles ranging from 30 to 200 nm in diameter and carry cargo for degradation by lysosomes and peroxisomes. MDVs share several features with sEVs, including targeted cargo degradation, biogenesis, packaging into multivesicular bodies, nucleic acid and protein transportation, induction of immune responses, and surface antigen presentation. MDVs may also be released from the cell in a manner similar to sEVs, potentially influencing intercellular communication and immune responses. Furthermore, the presence of MDVs presents opportunities for early disease detection, including neurodegenerative disorders and cancer. In this review, we explore the differences and similarities between MDVs and EVs, including their roles in immunity.

Adeno-associated virus (AAV)–mediated gene therapies face critical clinical limitations, including immune-mediated neutralization by pre-existing antibodies and dose-dependent hepatotoxicity. Extracellular vesicle-encapsulated AAVs (EV-AAVs) offer a promising solution by shielding AAVs from antibody recognition, yet existing production methods remain inefficient and impractical for clinical application. Here, we developed a cellular nanoporation (CNP) platform that enables scalable, high-yield generation of EV-AAVs, achieving an approximately 11-fold increase in production efficiency compared with conventional methods. In LDLR-deficient murine models with pre-existing neutralizing antibodies (1:200), EV-AAV-LDLR at half the standard AAV dose robustly restored hepatic LDL receptor expression and attenuated atherosclerosis progression. Notably, EV-AAV exhibited superior immune evasion capabilities, maintaining 2.3-fold higher hepatic transduction efficiency than conventional AAV upon secondary dosing due to antibody shielding. Importantly, EV-AAV therapy markedly reduced hepatotoxicity, with serum AST/ALT levels comparable to saline-treated controls, thereby overcoming a critical safety barrier of high-dose AAV treatment. These results demonstrate CNP as a clinically translatable platform for scalable EV-AAV manufacturing, enabling effective multi-dose regimens while overcoming key immunological and toxicity barriers in liver-directed gene therapy for familial hypercholesterolaemia.

Solid tissue-derived extracellular vesicles (ST-EVs) are extracellular vesicles (EVs) separated directly from solid tissues of both vertebrates and invertebrates. ST-EVs provide a physiologically relevant snapshot of tissue-specific molecular dynamics and can be enriched directly in situ, from tissues in their natural state, preserving the native characteristics of ST-EVs. However, their enrichment presents unique technical challenges compared to EVs derived from biofluids or cell culture media. The need for transparent reporting in ST-EV research is crucial to enhance the reproducibility, comparability, and reliability of research findings. The Solid Tissue Task Force, part of the Scientific Reproducibility Subcommittee of International Society for Extracellular Vesicles, aims to recommend reporting parameters and identify outstanding questions related to the pre-analytical and analytical handling of solid tissues, as well as ST-EV separation and characterization. These steps are essential for advancing the understanding of the biological roles of ST-EVs and their potential clinical applications.

The development of technologies for screening proteins that bind to specific tissues in vivo and facilitate delivery of large cargos remains challenging, with most approaches limited to cell culture systems that often yield clinically irrelevant hits. To overcome this limitation, we developed a novel molecular screening platform using an extracellular vesicle (EV) display library. EVs are natural molecular carriers capable of delivering diverse cargos, which can be engineered to enhance specificity and targeting through surface modifications. We constructed an EV-display library presenting monobody repertoires on EV surfaces, with genetic cargo inside the EVs corresponding to the displayed proteins. These libraries were screened for tissue specific delivery through serial passage in mice via sequential intravenous administration in and recovery of tissue-selected EVs and amplification of their encapsulated monobody genes at each passage. Our results demonstrated successful selection of tissue-specific targeting proteins, as revealed by fluorescence and bioluminescence imaging followed by DNA sequencing. To understand the stochastic relationship between displayed proteins and packaged genes, we developed a mathematical analysis that revealed the complex selection dynamics and demonstrated successful enrichment despite the imperfect correlation between phenotype and genotype. This EV-based monobody screening approach, combined with mathematical modelling, is a significant advancement in targeted drug delivery by leveraging the natural capabilities of EVs with the selection of targeting proteins in a physiologically relevant environment.

HIV-associated neurocognitive disorders (HAND) affect 30%–50% of individuals living with HIV on combination antiretroviral therapy, with Alzheimer ’s-like pathology as a potent comorbidity of HAND. Our previous studies have implicated hypoxia-inducible factor-1 alpha (HIF-1α) as a central regulator of HIV-1 Tat-mediated amyloid production in astrocytes, which are further released via astrocyte-derived extracellular vesicles (ADEVs), inducing synaptodendritic injury and Alzheimer's-like pathology in naive mice. Based on this premise, we hypothesized that ADEVs carrying HIF-1α-targeting small interfering RNA (siRNA) would alleviate HIV-1-induced Alzheimer's-like pathology and neurodegeneration in CD34+ NSG HIV-infected humanized mice. Intranasally administered mCherry-TSG101-tagged ADEVs in mice demonstrated efficacy of brain delivery, especially to the hippocampus and cortex. In CD34+ NSG mice infected with HIV-1, intranasal delivery of HIF-1α siRNA-loaded ADEVs suppressed HIF-1α, reduced amyloid precursor protein (APP), AβmoC64, Aβ fibrils, and hyperphosphorylated tau (pTau), dampened glial activation as indicated by reduced GFAP and IBA1 expression, and partially restored synaptic proteins, which were dysregulated due to HIV-1 infection. Trends of improvement were also observed in behavioural deficits in spatial memory, anxiety-like behaviour, and sensorimotor gating induced by HIV-1. These findings position HIF-1α as a pivotal mediator of HIV-associated Alzheimer's-like pathology and neurodegeneration in the CD34+ NSG mice and underscore the promising role of ADEV-mediated HIF-1α siRNA delivery as a non-invasive therapeutic strategy for HAND.

Retinal neovascular diseases are leading causes of global blindness. Migrasomes, organelles released during cell migration, play a role in intercellular communication and are present in M2 macrophages, which are critical to the pathology of retinal neovascular diseases. This study investigates the involvement of M2 macrophage-derived migrasomes in ischaemia-induced retinal neovascularization (RNV). Migrasomes are isolated from macrophages and characterized by Western blotting and transmission electron microscopy. Compared with controls, M2 macrophage-derived migrasomes significantly enhance human retinal microvascular endothelial cell (HREC) functions by Cell Counting Kit-8, transwell, and tube formation assays, and markedly contribute to the pathological retinal angiogenesis of oxygen-induced retinopathy (OIR) mice. Triggering receptor expressed on myeloid cells 2 (TREM2) is selected as the potential downstream target of M2 macrophage-derived migrasomes by proteomic analysis. Moreover, the depletion of M2 macrophages in OIR retinas reduces the levels of migrasomes and TREM2. BTC and PLA1A overexpression in HRECs could attenuate decreased HREC functions induced by sh-TREM2 M2 macrophage-derived migrasomes. These findings demonstrate that TREM2-enriched M2 macrophage-derived migrasomes contribute to pathological RNV in vivo and positively regulate HREC functions in vitro through targeting TREM2-BTC/PLA1A, which may serve as biomarkers and therapeutic targets for retinal neovascular diseases.

Grisard E., N. Nevo, A. Lescure, et al. (2022). Homosalate Boosts the Release of Tumour-Derived Extracellular Vesicles With Protection Against Anchorage-Loss Property. Journal of Extracellular Vesicles, 11, e12242. https://doi.org/10.1002/jev2.12242

In paragraph “4.2 Plasmids” of the “Materials and Methods” section, several typos and errors were inserted in the description of the NLuc-CD9 plasmid construction steps: (1) the indicated primer sequences corresponded to the DNA sequence of CD9 (with one base missing) rather than the actual primers in forward or reverse order with the additional restriction enzyme sequences; (2) the addgene reference of the GFP-HSP70 construct was missing one digit; (3) the enzyme used to excise GFP from this construct was mistakenly indicated as SpeI instead of AgeI. Consequently, instead of:

Nluc-CD9 construct was obtained as follows: CD9 sequence was first PCR-derived from tdTomato-CD9-10 construct (kind gift of Michael Davidson) using the indicated primers (Forward: CTCAAGCTTCCCCGGTCAAAGGAGGCA; Reverse: ATCCGCAGGAACCGCGAGATGGTCTAG). Then, a Renilla-luciferase-HSP70 construct previously obtained in our laboratory by removing GFP sequence from GFP-HSP70 construct (Addgene, #1525) with XhoI and SpeI restriction enzymes (New England Biolabs) was used as intermediate. Briefly, HSP70 sequence was removed from Renilla-luciferase-HSP70 and was replaced by CD9 sequence using XhoI and SpeI restriction enzymes. Finally, Renilla-luciferase sequence was removed using AgeI and XhoI restriction enzymes and was replaced by Nluc sequence using the same enzymes.

The right description should have been:

Nluc-CD9 construct was obtained as follows: CD9 sequence was first PCR-derived from tdTomato-CD9-10 construct (kind gift of Michael Davidson) using the indicated primers (Forward: ATTCTCGAGCTCAAGCTTCCACCGGTCAAAGGAGGCA; Reverse: ATTACTAGTCTAGACCATCTCGCGGTTCCTGCGGAT). Then, a Renilla-luciferase-HSP70 construct previously obtained in our laboratory by removing GFP sequence from GFP-HSP70 construct (Addgene, #15215) with AgeI and XhoI restriction enzymes (New England Biolabs) was used as intermediate. Briefly, HSP70 sequence was removed from Renilla-luciferase-HSP70 and was replaced by CD9 sequence using XhoI and SpeI restriction enzymes. Finally, Renilla-luciferase sequence was removed using AgeI and XhoI restriction enzymes and was replaced by Nluc sequence using the same enzymes.

We apologise for these errors.

Pediatric diffuse midline gliomas with the Histone 3 lysine 27-to-methionine mutation (H3K27M-pDMG) are aggressive brain tumors characterized by intrinsic resistance to radiation therapy, the current standard of care. These tumors exhibit significant intratumoral heterogeneity, with distinct subclonal populations likely contributing to therapy resistance. Emerging evidence suggests that small extracellular vesicles (sEV) mediate oncogenic signaling within glioma stem cell populations, yet their role under radiation-induced stress remains poorly understood. In this study, we characterized sEV uptake dynamics among H3K27M-pDMG tumor cells, identified key sEV surface proteins, and demonstrated that sEVs derived from radioresistant (RR) H3K27M-pDMG cells confer radioprotective effects on radiosensitive tumor cells. Molecular profiling revealed that RR-sEVs carry proteins, microRNAs (miRNAs) and metabolites associated with glycolysis, oxidative phosphorylation and DNA repair. Upon uptake, RR-sEVs reprogrammed recipient cells by altering gene expression and metabolic pathways, and enhancing DNA repair and survival following radiation exposure. These findings provide insights into the role of sEV-mediated intratumoral communication as a contributor to radiation resistance in H3K27M-pDMG and suggest potential therapeutic strategies to disrupt this process and enhance radiation efficacy.