Pub Date : 2020-05-31DOI: 10.15578/squalen.v15i1.471
Squalen Bulletin
{"title":"Preface Squalen Bulletin Vol. 15 No. 3 Tahun 2020","authors":"Squalen Bulletin","doi":"10.15578/squalen.v15i1.471","DOIUrl":"https://doi.org/10.15578/squalen.v15i1.471","url":null,"abstract":"","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"81094898","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2020-05-31DOI: 10.15578/squalen.v15i1.418
Giyatmi Giyatmi, Tika Annisa Eka Poetri, H. Irianto, D. Fransiska, Agusman Agusman
Waste disposal problems have attracted scientists around the world to explore the use of renewable resources to produce biodegradable films and coatings. Indonesia has diverse renewable resources of biopolymers that originated from seaweeds such as carrageenan, agar, and alginate. Carrageenan is considered as a potential biopolymer for edible film manufacture due to its characteristic range. This study aimed to develop carrageenan-based edible film using alginate and polyethylene glycol as plasticizers. Edible film made from k-carrageenan with the addition of alginate and polyethylene glycol (PEG) as plasticizers was tested for its mechanical properties, water vapor transmission rate (WVTR) and water solubility. Blending k-carrageenan with alginate (0%, 0.25%, 0.5%, 0.75%, and 1.0% w/v) increased tensile strength, thickness, and water solubility, but reduced elongation at break, WVTR, and moisture content. The addition of PEG (1%, 2%, and 3% w/v) reduced tensile strength and water solubility, but increased elongation at break, thickness, and moisture content. This study recommended that the best carrageenan-based edible film was obtained from a formula using 1% alginate (w/v) and 1% PEG (w/v).
{"title":"Effect of Alginate and Polyethylene Glycol Addition on Physical and Mechanical Characteristics of k-Carrageenan-based Edible Film","authors":"Giyatmi Giyatmi, Tika Annisa Eka Poetri, H. Irianto, D. Fransiska, Agusman Agusman","doi":"10.15578/squalen.v15i1.418","DOIUrl":"https://doi.org/10.15578/squalen.v15i1.418","url":null,"abstract":"Waste disposal problems have attracted scientists around the world to explore the use of renewable resources to produce biodegradable films and coatings. Indonesia has diverse renewable resources of biopolymers that originated from seaweeds such as carrageenan, agar, and alginate. Carrageenan is considered as a potential biopolymer for edible film manufacture due to its characteristic range. This study aimed to develop carrageenan-based edible film using alginate and polyethylene glycol as plasticizers. Edible film made from k-carrageenan with the addition of alginate and polyethylene glycol (PEG) as plasticizers was tested for its mechanical properties, water vapor transmission rate (WVTR) and water solubility. Blending k-carrageenan with alginate (0%, 0.25%, 0.5%, 0.75%, and 1.0% w/v) increased tensile strength, thickness, and water solubility, but reduced elongation at break, WVTR, and moisture content. The addition of PEG (1%, 2%, and 3% w/v) reduced tensile strength and water solubility, but increased elongation at break, thickness, and moisture content. This study recommended that the best carrageenan-based edible film was obtained from a formula using 1% alginate (w/v) and 1% PEG (w/v).","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"76478569","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2020-05-31DOI: 10.15578/squalen.v15i1.416
S. Ethica, S. Darmawati, S. S. Dewi, N. Nurrahman, A. R. Sulistyaningtyas
Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.
{"title":"Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study","authors":"S. Ethica, S. Darmawati, S. S. Dewi, N. Nurrahman, A. R. Sulistyaningtyas","doi":"10.15578/squalen.v15i1.416","DOIUrl":"https://doi.org/10.15578/squalen.v15i1.416","url":null,"abstract":"Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"82438377","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2020-05-30DOI: 10.15578/squalen.v15i1.437
D. Setijawati, A. Jaziri, H. S. Yufidasari, M. D. Pratomo, D. W. Wardani, D. Ersyah, N. Huda
Peptone is a hydrolysate product rich in amino acids, and it is uncoagulated at high temperature. Commercial peptone produced from land animals cannot be declared as acceptable in terms of lawfulness due to religious concerns. Catfish (Clarias gariepinus) and pangas catfish (Pangasius pangasius) are important species for the fish processing industry in Indonesia. The filleting process resulted in value by-products. The fish head as the by-products can be utilized as a main raw material for higher economic value products, such as peptone. The aim of this study was to characterize peptones extracted from the heads of catfish and pangas catfish with different acid conditions. The characteristics of chemical composition, yield, color parameter, solubility, amino acid content, bacterial growth rate and biomass production were observed. The catfish peptone (CFP) and pangas catfish peptone (PCP) obtained with different acid conditions showed high protein content in the range of 84.35% to 90.80% (P<0.05). The yields of CFP and PCP were significantly different (P<0.05) and varied between 4.75% and 5.66%. The solubility of treated peptones varied between 98.03% and 99.52%, and the peptones were rich in glycine, glutamic acid, proline and leucine. Bacterial growth test showed that both CFP and PCP had better growth rates compared to the commercial peptone tested in this study. In addition, the biomass production with peptone from catfish and pangas catfish was higher than that with the commercial product (P<0.05). This research proposed that catfish and pangas catfish heads could be developed as an alternative source for peptone production.
{"title":"Characteristics and Use of Peptones from Catfish (Clarias gariepinus) and Pangas Catfish (Pangasius pangasius) Heads as Bacterial Growth Media","authors":"D. Setijawati, A. Jaziri, H. S. Yufidasari, M. D. Pratomo, D. W. Wardani, D. Ersyah, N. Huda","doi":"10.15578/squalen.v15i1.437","DOIUrl":"https://doi.org/10.15578/squalen.v15i1.437","url":null,"abstract":"Peptone is a hydrolysate product rich in amino acids, and it is uncoagulated at high temperature. Commercial peptone produced from land animals cannot be declared as acceptable in terms of lawfulness due to religious concerns. Catfish (Clarias gariepinus) and pangas catfish (Pangasius pangasius) are important species for the fish processing industry in Indonesia. The filleting process resulted in value by-products. The fish head as the by-products can be utilized as a main raw material for higher economic value products, such as peptone. The aim of this study was to characterize peptones extracted from the heads of catfish and pangas catfish with different acid conditions. The characteristics of chemical composition, yield, color parameter, solubility, amino acid content, bacterial growth rate and biomass production were observed. The catfish peptone (CFP) and pangas catfish peptone (PCP) obtained with different acid conditions showed high protein content in the range of 84.35% to 90.80% (P<0.05). The yields of CFP and PCP were significantly different (P<0.05) and varied between 4.75% and 5.66%. The solubility of treated peptones varied between 98.03% and 99.52%, and the peptones were rich in glycine, glutamic acid, proline and leucine. Bacterial growth test showed that both CFP and PCP had better growth rates compared to the commercial peptone tested in this study. In addition, the biomass production with peptone from catfish and pangas catfish was higher than that with the commercial product (P<0.05). This research proposed that catfish and pangas catfish heads could be developed as an alternative source for peptone production.","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"74185273","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2020-05-30DOI: 10.15578/squalen.v15i1.468
Bulletin Squalen
{"title":"Front Cover Squalen Bulletin Vol. 15 No. 1 Tahun 2020","authors":"Bulletin Squalen","doi":"10.15578/squalen.v15i1.468","DOIUrl":"https://doi.org/10.15578/squalen.v15i1.468","url":null,"abstract":"","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"81824277","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2020-05-30DOI: 10.15578/squalen.v15i1.441
Aldino Dityanawarman, Indun Puspita Dewi, S. Ratnawati, N. Ekantari, M. Tamplin
One of an important quality parameter in tuna is the level of histamine content. The contamination of histamine in tuna is mainly due to the activity of histidine decarboxylase produced by the bacteria. A rapid growth of histamine producing bacteria is correlated with the practice of temperature abuse during handling. This study aimed to develop predictive growth modeling of two histamine-producing bacteria in the function of temperature. The growth and histamine production of Klebsiella sp. CK02 and Morganella morganii ATCC 25830 at various temperatures were measured in tryptic soy broth histidine (TSBH) and tuna fish infusion broth (TFIB) growth media. Broths were incubated at 4°C and 15°C for 7 days, and at 30°C and 40°C for 24 hours. The Baranyi and Roberts model was used with DMFit to determine primary growth kinectics, and the Ratkowsky square root model to describe bacterial growth rate as a function of temperature. Histamine production was enumerated by the apparent yield factor (pYhis/CFU) value. Growth rate increased with temperature, with a maximum rate at 40°C for Klebsiella sp. CK02 (0.740 log CFU/h) and M. morganii (0.578 log CFU/h). The Tmin for Klebsiella sp. CK02 in TFIB was -8.9°C, indicating better survival in low storage temperature, compare to M. morganii ATCC 25830. In addition, Klebsiella sp. CK02 produced a lower pYhis/CFU at 15 and 30°C compared to M. morganii ATCC 25830.
{"title":"Growth Rate and Histamine Production of Klebsiella sp. CK02 Isolated from Skipjack Tuna Compared with Morganella morganii ATCC 25830 at Various Incubation Temperatures","authors":"Aldino Dityanawarman, Indun Puspita Dewi, S. Ratnawati, N. Ekantari, M. Tamplin","doi":"10.15578/squalen.v15i1.441","DOIUrl":"https://doi.org/10.15578/squalen.v15i1.441","url":null,"abstract":"One of an important quality parameter in tuna is the level of histamine content. The contamination of histamine in tuna is mainly due to the activity of histidine decarboxylase produced by the bacteria. A rapid growth of histamine producing bacteria is correlated with the practice of temperature abuse during handling. This study aimed to develop predictive growth modeling of two histamine-producing bacteria in the function of temperature. The growth and histamine production of Klebsiella sp. CK02 and Morganella morganii ATCC 25830 at various temperatures were measured in tryptic soy broth histidine (TSBH) and tuna fish infusion broth (TFIB) growth media. Broths were incubated at 4°C and 15°C for 7 days, and at 30°C and 40°C for 24 hours. The Baranyi and Roberts model was used with DMFit to determine primary growth kinectics, and the Ratkowsky square root model to describe bacterial growth rate as a function of temperature. Histamine production was enumerated by the apparent yield factor (pYhis/CFU) value. Growth rate increased with temperature, with a maximum rate at 40°C for Klebsiella sp. CK02 (0.740 log CFU/h) and M. morganii (0.578 log CFU/h). The Tmin for Klebsiella sp. CK02 in TFIB was -8.9°C, indicating better survival in low storage temperature, compare to M. morganii ATCC 25830. In addition, Klebsiella sp. CK02 produced a lower pYhis/CFU at 15 and 30°C compared to M. morganii ATCC 25830.","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"81241994","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2020-05-30DOI: 10.15578/squalen.v15i1.435
T. Purbonegoro, S. Suratno
Mercury (Hg) contaminated seafood can cause severe health problems if it is consumed regularly. Mercury is very dangerous for humans because it can damage or reduce the function of the central nervous system, blood composition, lungs, kidneys, and other vital organs. This metal can also cause birth defects in newly born babies. The objectives of this study were to determine the concentration of total mercury (THg) in clams (Periglypta crispata) collected from Kepulauan Seribu Regency and the safe amount per week for consuming them. The safe amount (kg per week) to consume this clam was calculated by the Maximum Tolerable Intake (MTI) method. Our results showed that the average concentration of THg in the clams was 0.18±0.07 mg/kg wet weight. Among the analyzed organs, THg accumulation was highest in the digestive tract tissues. The clams were still safe to be consumed by humans since the THg concentration in these clams has not exceeded the maximum limit of heavy metal in seafood (0.5 mg/kg) set by the government of Indonesia. The safe amount to consume these clams was 0.53 kg per week, to avoid the adverse effect of Hg to human health.
{"title":"Health Risk Assessment Related to Total Mercury (THg) Concentration in Clam (Periglypta crispata) from Kepulauan Seribu Regency, Indonesia","authors":"T. Purbonegoro, S. Suratno","doi":"10.15578/squalen.v15i1.435","DOIUrl":"https://doi.org/10.15578/squalen.v15i1.435","url":null,"abstract":"Mercury (Hg) contaminated seafood can cause severe health problems if it is consumed regularly. Mercury is very dangerous for humans because it can damage or reduce the function of the central nervous system, blood composition, lungs, kidneys, and other vital organs. This metal can also cause birth defects in newly born babies. The objectives of this study were to determine the concentration of total mercury (THg) in clams (Periglypta crispata) collected from Kepulauan Seribu Regency and the safe amount per week for consuming them. The safe amount (kg per week) to consume this clam was calculated by the Maximum Tolerable Intake (MTI) method. Our results showed that the average concentration of THg in the clams was 0.18±0.07 mg/kg wet weight. Among the analyzed organs, THg accumulation was highest in the digestive tract tissues. The clams were still safe to be consumed by humans since the THg concentration in these clams has not exceeded the maximum limit of heavy metal in seafood (0.5 mg/kg) set by the government of Indonesia. The safe amount to consume these clams was 0.53 kg per week, to avoid the adverse effect of Hg to human health.","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78968152","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2020-05-30DOI: 10.15578/squalen.v15i1.470
Bulletin Squalen
{"title":"Back Cover Squalen Bulletin Vol. 15 No. 1 Tahun 2020","authors":"Bulletin Squalen","doi":"10.15578/squalen.v15i1.470","DOIUrl":"https://doi.org/10.15578/squalen.v15i1.470","url":null,"abstract":"","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"90760407","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2019-12-31DOI: 10.15578/squalen.v14i3.399
D. Dwiyitno
Emerging contaminants (ECs) or contaminants of emerging concern (CECs) has become global awareness of researcher since few decades ago, including Indonesia. Intensive usage of industrial compounds has led to the massive emission to the environment and therefore their potential adverse effect may endanger aquatic organism and human health. Based on the available literatures, organotins and flame retardants as two main groups of ECs from industrial emission identified in Indonesian seafood, as well as worldwide. However, concentration both ECs group detected in Indonesian seafood are relatively low than that in developed countries and the majority of South East Asian countries. Aryl hydrocarbons are reported by only minor literatures in Indonesia and Japan suggested minor interest on the investigation to this compound group. Toxicological studies revealed that ECs emitted from industrial activities has to be concern, ash most of the ECs attributed to endocrine disrupting chemicals. Nevertheless, study on the exposure assessment of ECs in Indonesia is very limited. Regulation issue and laboratory approach are among future focus to be concern in addressing ECs in Indonesia, especially from industrial emission.
{"title":"Emerging Contaminants In Indonesian Seafood From Industrial Emission And Their Health Hazards","authors":"D. Dwiyitno","doi":"10.15578/squalen.v14i3.399","DOIUrl":"https://doi.org/10.15578/squalen.v14i3.399","url":null,"abstract":"Emerging contaminants (ECs) or contaminants of emerging concern (CECs) has become global awareness of researcher since few decades ago, including Indonesia. Intensive usage of industrial compounds has led to the massive emission to the environment and therefore their potential adverse effect may endanger aquatic organism and human health. Based on the available literatures, organotins and flame retardants as two main groups of ECs from industrial emission identified in Indonesian seafood, as well as worldwide. However, concentration both ECs group detected in Indonesian seafood are relatively low than that in developed countries and the majority of South East Asian countries. Aryl hydrocarbons are reported by only minor literatures in Indonesia and Japan suggested minor interest on the investigation to this compound group. Toxicological studies revealed that ECs emitted from industrial activities has to be concern, ash most of the ECs attributed to endocrine disrupting chemicals. Nevertheless, study on the exposure assessment of ECs in Indonesia is very limited. Regulation issue and laboratory approach are among future focus to be concern in addressing ECs in Indonesia, especially from industrial emission.","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2019-12-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"73504138","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Pub Date : 2019-12-31DOI: 10.15578/squalen.v14i3.385
J. Basmal, Muhamad Luthfian Henrida, R. Kusumawati, N. Nurhayati
The solid waste from agar processing industries in Indonesia is enormous. The waste contains numbers of macro and micro nutrient including growth hormone that can be a good source for plant fertilizer. Utilization of solid waste obtained from agar processing into fertilizer has been carried out by mixing with Sargassum powder, fish silage and Eucheuma cottonii pasta. Various concentrations of the solid waste (13, 19, 22 and 25%) and the Sargassum powder (0, 3, 6, 9, and 12%) were used in this study to obtain optimum nutrients in the formulated fertilizers i.e. growth hormone, total nitrogen and potassium. Growth hormone were analyzed using high-performance liquid chromatography (HPLC), while N content by Kjeldahl methods and K content analyzed according AOAC.The results showed that the optimum formulation was obtained from the combination of 25% solid waste and 0% Sargassum powder, which contained the highest growth hormones i.e. auxins (IAA) 46.75 ppm, gibberellin (GA3) 22.25 ppm, cytokinin-zeatin 18.50 ppm, and cytokinin-kinetin 61.00 ppm. While the potassium content was 0.43±0.001 ppm and the total nitrogen was 0.53± 0.06%. This result meets the requirements of the Minister of Agriculture Regulation No. 261/KPTS/SR.310/M/4/2019 regarding the requirements for total N in organic fertilizer. However, the total K+ does not meet the requirement. Therefore, enrichment with other organic raw material is still needed.
{"title":"Growth Hormone, Nitrogen and Potassium Content in The Formulated Solid Waste from Agar Processing for Fertilizer Application","authors":"J. Basmal, Muhamad Luthfian Henrida, R. Kusumawati, N. Nurhayati","doi":"10.15578/squalen.v14i3.385","DOIUrl":"https://doi.org/10.15578/squalen.v14i3.385","url":null,"abstract":"The solid waste from agar processing industries in Indonesia is enormous. The waste contains numbers of macro and micro nutrient including growth hormone that can be a good source for plant fertilizer. Utilization of solid waste obtained from agar processing into fertilizer has been carried out by mixing with Sargassum powder, fish silage and Eucheuma cottonii pasta. Various concentrations of the solid waste (13, 19, 22 and 25%) and the Sargassum powder (0, 3, 6, 9, and 12%) were used in this study to obtain optimum nutrients in the formulated fertilizers i.e. growth hormone, total nitrogen and potassium. Growth hormone were analyzed using high-performance liquid chromatography (HPLC), while N content by Kjeldahl methods and K content analyzed according AOAC.The results showed that the optimum formulation was obtained from the combination of 25% solid waste and 0% Sargassum powder, which contained the highest growth hormones i.e. auxins (IAA) 46.75 ppm, gibberellin (GA3) 22.25 ppm, cytokinin-zeatin 18.50 ppm, and cytokinin-kinetin 61.00 ppm. While the potassium content was 0.43±0.001 ppm and the total nitrogen was 0.53± 0.06%. This result meets the requirements of the Minister of Agriculture Regulation No. 261/KPTS/SR.310/M/4/2019 regarding the requirements for total N in organic fertilizer. However, the total K+ does not meet the requirement. Therefore, enrichment with other organic raw material is still needed.","PeriodicalId":21935,"journal":{"name":"Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2019-12-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"90401111","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
京公网安备 11010802042870号
京ICP备2023020795号-1
扫码关注我们
求助内容：
应助结果提醒方式：