Collagen and silicone are substances commonly used as dermal filler in a number of beauty procedures. However, sometimes these chemicals cause unwanted side effects on the skin. The purpose of this research is to analyse the effect of collagen and silicone subdermal injection on rat skin as a model for human skin. Materials in this research are 9 Wistar rats (Rattus norvegicus) divided into three groups with a number of 3 rats in each group. The first control group (K) is not given any injections, while KI and KII are injected with 0,1 ml collagen and 0,1 ml silicone respectively. On the third day, all groups are observed for macroscopic changes. Skin samples are taken by necropsy and are made into slides using HE stain. All procedures done are approved by the ethics commission of LLPT, UGM, Yogyakarta with the certificate number 00024/04/LPPT/V/2019. The slides are observed under a microscope with 20x and 40x magnification. Any microscopic changes are noted, also epidermis and dermis lengths are measured. Mild hyperkeratosis, inflammation and proliferation of connective tissue are found. The measurements of the epidermis and dermis are analysed using T-test independent method in the program Statistical Product and Service Solution (SPSS). The mean length of the epidermis is a little thicker than normal but is not significant (P>0,05). The results of this research show that the subdermal injection of 0,1 ml collagen and 0,1 ml silicone on rats do not cause significant macroscopic or microscopic changes.
{"title":"Subdermal Silicone and Collagen Injection Effect on the Skin of Rats (Rattus norvegicus) on the Third Day After Injection","authors":"Janice Viary, Y. P. Kristianingrum","doi":"10.22146/jsv.62198","DOIUrl":"https://doi.org/10.22146/jsv.62198","url":null,"abstract":"Collagen and silicone are substances commonly used as dermal filler in a number of beauty procedures. However, sometimes these chemicals cause unwanted side effects on the skin. The purpose of this research is to analyse the effect of collagen and silicone subdermal injection on rat skin as a model for human skin. Materials in this research are 9 Wistar rats (Rattus norvegicus) divided into three groups with a number of 3 rats in each group. The first control group (K) is not given any injections, while KI and KII are injected with 0,1 ml collagen and 0,1 ml silicone respectively. On the third day, all groups are observed for macroscopic changes. Skin samples are taken by necropsy and are made into slides using HE stain. All procedures done are approved by the ethics commission of LLPT, UGM, Yogyakarta with the certificate number 00024/04/LPPT/V/2019. The slides are observed under a microscope with 20x and 40x magnification. Any microscopic changes are noted, also epidermis and dermis lengths are measured. Mild hyperkeratosis, inflammation and proliferation of connective tissue are found. The measurements of the epidermis and dermis are analysed using T-test independent method in the program Statistical Product and Service Solution (SPSS). The mean length of the epidermis is a little thicker than normal but is not significant (P>0,05). The results of this research show that the subdermal injection of 0,1 ml collagen and 0,1 ml silicone on rats do not cause significant macroscopic or microscopic changes. ","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-04-19","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75520689","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
S. Widyarini, Sugiyono Sultan, Yuli Purwandari Kristiangingrum, B. Sutrisno
Penelitian ini dilakukan untuk mengamati gambaran histomorfologis (berdasarkan pada histogenesis dan sifat pertumbuhan tumor), pada berbagai sampel tumor dari hewan kesayangan (anjing dan kucing) dan wild animals (beruang) koleksi Departemen Patologi Fakultas Kedokteran Hewan Universitas Gadjah Mada. Duapuluh satu sampel (22) dari organ yang diduga jaringan tumor yang diperoleh dari Dokter Hewan Praktisi maupun Rumah Sakit Hewan selama tahun 2019 digunakan dalam penelitian ini. Semua sampel tersimpan dalam kontener berisi larutan formalin 10%. Selanjutnya sampel diproses dan diwarnai dengan Hematoxylin-Eosin. Pengamatan terhadap histogenesis dan sifat pertumbuhan tumor dilakulan dengan menggunakan mikroskop cahaya dengam pembesaran 200X dan 400X dan selanjutnya dilakukan dokumentasi dengan pengambilan foto. Analisis dilakukan secara deskriptif dengan membandingan dengan referensi histomofologis tumor pada hewan. Hasil penelitian memperlihatkan bahwa selama tahun 2019, jumlah sampel tumor kulit dilaporkan paling banyak 63.63% (14/22), diikuti dengan jumlah sampel tumor pada kelenjar mammae 22,72% (5/22), liver-duktus biliverus 18.18% (4/22), tulang 4,54% (1/22) dan metastasis paru-paru dan metastasis paru-paru dari jaringan tulang sejumlah 4,54% (1/22). Hewan asal tumor paling banyak ditemukan pada kucing dan anjing masing-masing 59% dan 34%. Hasil pengamatan terhadap gambaran histomorfologis ditemukan adenokarsinoma mammae (tubulopapillary carsinoma, solid adenocarsinoma, lipid-rich adenokarsinoma), fibroadenomatous hiperplasia mammae, karsinoma sel skuamosa, papiloma, adenoma kelenjar hepatoid, melanositosis, fibrosarkoma, kolangiokarsinoma dan osteosarkoma.
{"title":"STUDI HISTOPATOLOGIS TUMOR PADA HEWAN KESAYANGAN AND WILD ANIMAL","authors":"S. Widyarini, Sugiyono Sultan, Yuli Purwandari Kristiangingrum, B. Sutrisno","doi":"10.22146/jsv.70506","DOIUrl":"https://doi.org/10.22146/jsv.70506","url":null,"abstract":"Penelitian ini dilakukan untuk mengamati gambaran histomorfologis (berdasarkan pada histogenesis dan sifat pertumbuhan tumor), pada berbagai sampel tumor dari hewan kesayangan (anjing dan kucing) dan wild animals (beruang) koleksi Departemen Patologi Fakultas Kedokteran Hewan Universitas Gadjah Mada. Duapuluh satu sampel (22) dari organ yang diduga jaringan tumor yang diperoleh dari Dokter Hewan Praktisi maupun Rumah Sakit Hewan selama tahun 2019 digunakan dalam penelitian ini. Semua sampel tersimpan dalam kontener berisi larutan formalin 10%. Selanjutnya sampel diproses dan diwarnai dengan Hematoxylin-Eosin. Pengamatan terhadap histogenesis dan sifat pertumbuhan tumor dilakulan dengan menggunakan mikroskop cahaya dengam pembesaran 200X dan 400X dan selanjutnya dilakukan dokumentasi dengan pengambilan foto. Analisis dilakukan secara deskriptif dengan membandingan dengan referensi histomofologis tumor pada hewan. Hasil penelitian memperlihatkan bahwa selama tahun 2019, jumlah sampel tumor kulit dilaporkan paling banyak 63.63% (14/22), diikuti dengan jumlah sampel tumor pada kelenjar mammae 22,72% (5/22), liver-duktus biliverus 18.18% (4/22), tulang 4,54% (1/22) dan metastasis paru-paru dan metastasis paru-paru dari jaringan tulang sejumlah 4,54% (1/22). Hewan asal tumor paling banyak ditemukan pada kucing dan anjing masing-masing 59% dan 34%. Hasil pengamatan terhadap gambaran histomorfologis ditemukan adenokarsinoma mammae (tubulopapillary carsinoma, solid adenocarsinoma, lipid-rich adenokarsinoma), fibroadenomatous hiperplasia mammae, karsinoma sel skuamosa, papiloma, adenoma kelenjar hepatoid, melanositosis, fibrosarkoma, kolangiokarsinoma dan osteosarkoma. ","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-04-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"90535343","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
B. Sutrisno, R. Wasito, S. Widyarini, Yuli Purwandari Kristianingrum, S. .
Penelitian ini bertujuan untuk melihat gangguan pertumbuhan jaringan limfoid primer dan sekunder yang menderita omphalitis dengan pemeriksaan histopatologi diwarnai dengan pewarnaan hematoksilin-eosin rutin dan pewarnaan imunohistokimia streptavidin biotin terhadap interleukin-10 (IL-10) pada ayam muda. Ayam umur 24 hari (DOC) broiler digunakan dan dikumpulkan dari tempat penetasan yang sama di Jawa Tengah di Indonesia. Semua 24 DOC dibagi menjadi dua kelompok yang masing-masing terdiri dari 12 DOC (Grup A) dan 12 DOC omphalitic (Grup B). Semua DOC dirawat di kandang yang berbeda, diberi makan dan diminum di libitum. Pada hari ke 3, 6 dan 9, empat ekor ayam dari masing-masing kelompok ditimbang untuk kemudian dinekropsi. Timus, bursa fabricius dan limpa dikumpulkan dan ditimbang. Semua jaringan diproses secara histopatologi dengan pewarnaan hematoksilin-eosin rutin dan pewarnaan biotin streptavidin imunohistokimia imunopatologi. Data indeks berat limpa, bursa Fabricius dan tymus dianalisis menggunakan program statistik IBM SPSS versi 22. Hasil penelitian menunjukkan bahwa indeks bobot limpa, bursa fabricius dan timus ayam omphalitic (kelompok B) lebih rendah dibandingkan dengan indeks bobot ayam sehat (kelompok A). Indeks berat timus berbeda nyata (P <0, 05). Lesi histopatologis pada organ limfoid diamati pada semua ayam di Grup B. Lesi ditandai dengan penipisan dan nekrosis limfosit. Ayam dari Grup A tidak mengalami perubahan pada organ limfoid. Biotin streptavidin immunostaining dengan ekspresi antibodi policlonal anti IL-10 pada bursa Fabricius pada ayam omphalitic (Grup B) memiliki IL-10 yang sangat sedikit jika dibandingkan dengan ayam sehat (Grup A). Kesimpulan, omfalitis menyebabkan penurunan indeks berat badan yang signifikan dan gangguan pertumbuhan organ limfoid yang ditandai dengan deplesi dan nekrosis limfosit.
{"title":"Gangguan Pertumbuhan Organ Limfoid Ayam Broiler yang Menderita Omfalitis","authors":"B. Sutrisno, R. Wasito, S. Widyarini, Yuli Purwandari Kristianingrum, S. .","doi":"10.22146/jsv.60465","DOIUrl":"https://doi.org/10.22146/jsv.60465","url":null,"abstract":"Penelitian ini bertujuan untuk melihat gangguan pertumbuhan jaringan limfoid primer dan sekunder yang menderita omphalitis dengan pemeriksaan histopatologi diwarnai dengan pewarnaan hematoksilin-eosin rutin dan pewarnaan imunohistokimia streptavidin biotin terhadap interleukin-10 (IL-10) pada ayam muda. Ayam umur 24 hari (DOC) broiler digunakan dan dikumpulkan dari tempat penetasan yang sama di Jawa Tengah di Indonesia. Semua 24 DOC dibagi menjadi dua kelompok yang masing-masing terdiri dari 12 DOC (Grup A) dan 12 DOC omphalitic (Grup B). Semua DOC dirawat di kandang yang berbeda, diberi makan dan diminum di libitum. Pada hari ke 3, 6 dan 9, empat ekor ayam dari masing-masing kelompok ditimbang untuk kemudian dinekropsi. Timus, bursa fabricius dan limpa dikumpulkan dan ditimbang. Semua jaringan diproses secara histopatologi dengan pewarnaan hematoksilin-eosin rutin dan pewarnaan biotin streptavidin imunohistokimia imunopatologi. Data indeks berat limpa, bursa Fabricius dan tymus dianalisis menggunakan program statistik IBM SPSS versi 22. Hasil penelitian menunjukkan bahwa indeks bobot limpa, bursa fabricius dan timus ayam omphalitic (kelompok B) lebih rendah dibandingkan dengan indeks bobot ayam sehat (kelompok A). Indeks berat timus berbeda nyata (P <0, 05). Lesi histopatologis pada organ limfoid diamati pada semua ayam di Grup B. Lesi ditandai dengan penipisan dan nekrosis limfosit. Ayam dari Grup A tidak mengalami perubahan pada organ limfoid. Biotin streptavidin immunostaining dengan ekspresi antibodi policlonal anti IL-10 pada bursa Fabricius pada ayam omphalitic (Grup B) memiliki IL-10 yang sangat sedikit jika dibandingkan dengan ayam sehat (Grup A). Kesimpulan, omfalitis menyebabkan penurunan indeks berat badan yang signifikan dan gangguan pertumbuhan organ limfoid yang ditandai dengan deplesi dan nekrosis limfosit. ","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"80637022","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
N. Y. Hendarta, A. Kusumawati, T. Wibawa, A. T. Aman
Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus; hybridization; nucleic acid lateral flow; serotyping
{"title":"Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development","authors":"N. Y. Hendarta, A. Kusumawati, T. Wibawa, A. T. Aman","doi":"10.22146/jsv.44696","DOIUrl":"https://doi.org/10.22146/jsv.44696","url":null,"abstract":"Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus; hybridization; nucleic acid lateral flow; serotyping","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89949500","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Dehydration is defined as a lack of body fluids followed by loss of electrolytes, and changes in acid-base balance. The type of dehydration is limited based on the concentration of sodium in serum at the time of dehydration. Maintenance of osmotic pressure and distribution of several compartments of body fluids are the main functions of the four major electrolytes, namely sodium (Na +), potassium (K +), chloride (Cl‾), and bicarbonate (HCO3‾). Sodium is the most cation in extracellular fluid, most potassium cation in intracellular fluid and chloride is the most anion in extracellular fluid. The purpose of this study was to identify the type of dehydration and to determine the major electrolyte profile in cats in Yogyakarta and its surroundings. This study used 18 sick cats that were thought to be dehydrated, marked by decreased skin turgor, CRT> 2 seconds, and 12 cats that were suspected of having electrolyte balance disorders with symptoms of ascites, uropoetic disorders. Blood was drawn for all cats to measure Pack Cells Volume (PCV) levels. Patient clinical data and patient diagnosis were recorded, cats with changes in serum PCV levels were separated for examination of levels of sodium, chloride, potassium using Seamaty SMT-120V. The type of dehydration is identified based on the sodium level in the serum of a dehydrated cat. The results showed that most of the cat patients were dehydrated had low serum sodium levels (hyponatremia). There was 1 cat patient had low chloride levels. Potassium levels in cats with UT obstruction increased, which led to a decrease in the Na: K ratio. Cat bicarbonate levels did not show any change. From the results of the study it was concluded that dehydration in cats at Prof. Soeparwi is hypotonic dehydration (71%). The sodium profile mostly decreased, chloride and bicarbonate levels did not change, while there were changes in potassium levels in patients with UT disorders. The advice given is to check electrolytes before doing fluid therapy. Prior to electrolyte testing, dehydrated cats can be given a sodium solution.
{"title":"Identifikasi Tipe Dehidrasi dan Profil Elektrolit Mayor pada Pasien Kucing di Rumah Sakit Hewan Prof. Soeparwi dan Beberapa Klinik Hewan di Wilayah Yogyakarta","authors":"Guntari Titik Mulyani, Setyo Budhi, Kurnia .","doi":"10.22146/jsv.69901","DOIUrl":"https://doi.org/10.22146/jsv.69901","url":null,"abstract":"Dehydration is defined as a lack of body fluids followed by loss of electrolytes, and changes in acid-base balance. The type of dehydration is limited based on the concentration of sodium in serum at the time of dehydration. Maintenance of osmotic pressure and distribution of several compartments of body fluids are the main functions of the four major electrolytes, namely sodium (Na +), potassium (K +), chloride (Cl‾), and bicarbonate (HCO3‾). Sodium is the most cation in extracellular fluid, most potassium cation in intracellular fluid and chloride is the most anion in extracellular fluid. The purpose of this study was to identify the type of dehydration and to determine the major electrolyte profile in cats in Yogyakarta and its surroundings. This study used 18 sick cats that were thought to be dehydrated, marked by decreased skin turgor, CRT> 2 seconds, and 12 cats that were suspected of having electrolyte balance disorders with symptoms of ascites, uropoetic disorders. Blood was drawn for all cats to measure Pack Cells Volume (PCV) levels. Patient clinical data and patient diagnosis were recorded, cats with changes in serum PCV levels were separated for examination of levels of sodium, chloride, potassium using Seamaty SMT-120V. The type of dehydration is identified based on the sodium level in the serum of a dehydrated cat. The results showed that most of the cat patients were dehydrated had low serum sodium levels (hyponatremia). There was 1 cat patient had low chloride levels. Potassium levels in cats with UT obstruction increased, which led to a decrease in the Na: K ratio. Cat bicarbonate levels did not show any change. From the results of the study it was concluded that dehydration in cats at Prof. Soeparwi is hypotonic dehydration (71%). The sodium profile mostly decreased, chloride and bicarbonate levels did not change, while there were changes in potassium levels in patients with UT disorders. The advice given is to check electrolytes before doing fluid therapy. Prior to electrolyte testing, dehydrated cats can be given a sodium solution. ","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78601266","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan pengobatan. Perkembangan lebih lanjut dari resistensi bakteri dapat menyebabkan munculnya multidrug resistance pada bakteri, sehingga meningkatkan morbiditas dan mortalitas penyakit. Interaksi penyebaran kejadian multidrug resistance pada Escherichia coli yang terjadi pada populasi sangat kompleks, sehingga sulit memahami dinamika penyebaran berskala besar. Pendekatan pemodelan menjadi sangat penting untuk pengambilan keputusan tentang program pengendalian penyakit infeksi. Penelitian ini merupakan penelitian epidemiologi deskriptif analitik dengan desain cross-sectional study. Metode analisis menggunakan analisis regresi logistic untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat ternak, dan menggunakan regresi linier untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat peternakan. Hasil dari penelitian ini menunjukkan Distribusi kasus kejadian multidrug resistance pada ayam komersial di Kabupaten Blitar menunjukkan prevalensi kejadian pada tingkat peternakan sebesar 95.9%. Pemodelan kejadian multidrug resistance bakteri Escherichia coli tingkat ternak menghasilkan model regresi logistik ganda Ln () = 0.21964 + 1.60374 RefTS + 1.44989 Broiler + 0.96022 PakRacik + 0.84182 ProgAb – 1.16667 SaniKan – 1.15046 Tritendap, dengan peluang kejadian sebesar 94 %. Pemodelan kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan menghasilkan model regresi linier, MDR (Y) = 0.57886 + 0.16105 JUMitra + 0.19342 ProgAb – 0.16178 Dukudrh. Model ini memiliki wilk saphiro mendekati 1 (W = 0,9573) sehingga model persamaan ini merupakan model yang baik untuk kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan.
{"title":"Pemodelan Epidemiologi Kejadian Multidrug Resistance Bakteri Escherichia coli pada Peternakan Ayam Komersial di Kabupaten Blitar","authors":"Freshinta Jellia Wibisono, Bambang Sumiarto, Tri Untari, Mustofa Helmi Effendi, Diani Permatasari, Adiana Mutamsari Witaningrum","doi":"10.22146/jsv.52071","DOIUrl":"https://doi.org/10.22146/jsv.52071","url":null,"abstract":"Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan pengobatan. Perkembangan lebih lanjut dari resistensi bakteri dapat menyebabkan munculnya multidrug resistance pada bakteri, sehingga meningkatkan morbiditas dan mortalitas penyakit. Interaksi penyebaran kejadian multidrug resistance pada Escherichia coli yang terjadi pada populasi sangat kompleks, sehingga sulit memahami dinamika penyebaran berskala besar. Pendekatan pemodelan menjadi sangat penting untuk pengambilan keputusan tentang program pengendalian penyakit infeksi. Penelitian ini merupakan penelitian epidemiologi deskriptif analitik dengan desain cross-sectional study. Metode analisis menggunakan analisis regresi logistic untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat ternak, dan menggunakan regresi linier untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat peternakan. Hasil dari penelitian ini menunjukkan Distribusi kasus kejadian multidrug resistance pada ayam komersial di Kabupaten Blitar menunjukkan prevalensi kejadian pada tingkat peternakan sebesar 95.9%. Pemodelan kejadian multidrug resistance bakteri Escherichia coli tingkat ternak menghasilkan model regresi logistik ganda Ln () = 0.21964 + 1.60374 RefTS + 1.44989 Broiler + 0.96022 PakRacik + 0.84182 ProgAb – 1.16667 SaniKan – 1.15046 Tritendap, dengan peluang kejadian sebesar 94 %. Pemodelan kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan menghasilkan model regresi linier, MDR (Y) = 0.57886 + 0.16105 JUMitra + 0.19342 ProgAb – 0.16178 Dukudrh. Model ini memiliki wilk saphiro mendekati 1 (W = 0,9573) sehingga model persamaan ini merupakan model yang baik untuk kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan.","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84982484","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Surya Agus Prihatno, Abdul Samik, Dea Indriani Astuti, M. Agil, Usamah Afiff, Anriansyah Renggaman, D. Setiadi, Yosua Kristian Adi
Repeat breeding is condition of cows that have normal or near normal estrous cycles but fail to become pregnant after several insemination. In this study, we investigated the microbes in the cervical and vaginal mucus of beef cattle and dairy cows that experience repeat breeding and detected the pregnancy after the third or more artificial insemination. A total of 14 beef cattle and 6 dairy cows that experience repeat breeding in the cattle herd in the Yogyakarta region of Indonesia were used as samples in this study. Cervical and vaginal mucus samples were collected using plastic sheet when the cow was re-estrus. The samples were put into the 5 ml Brain Heart Infusion Broth for bacterial isolation and identification. Pregnancy examination was carried out on day 45 after artificial insemination using ultrasound method. Bacteria that could be isolated and identified from cervical mucus and vaginal mucus of beef cattle and dairy cows included Bacillus sp., Staphylococcus epidermidis, Staphylococcus aureus, and Pseudomonas sp. Some cows detected positive in pregnancy examination even though the bacteria were presence in the cervical and/or vaginal mucus. There was various composition of bacteria found in the cervical mucus and vaginal mucus, of beef cattle and dairy cows with repeat breeding in livestock groups in Yogyakarta. The presence of bacterial in the cervical and vaginal mucus during estrus was not always become the causes of failed pregnancy.
{"title":"Identifikasi Mikroba dari Lendir Estrus dan Deteksi Kebuntingan Sapi Kawin Berulang di Sleman, Yogyakarta","authors":"Surya Agus Prihatno, Abdul Samik, Dea Indriani Astuti, M. Agil, Usamah Afiff, Anriansyah Renggaman, D. Setiadi, Yosua Kristian Adi","doi":"10.22146/jsv.70916","DOIUrl":"https://doi.org/10.22146/jsv.70916","url":null,"abstract":"Repeat breeding is condition of cows that have normal or near normal estrous cycles but fail to become pregnant after several insemination. In this study, we investigated the microbes in the cervical and vaginal mucus of beef cattle and dairy cows that experience repeat breeding and detected the pregnancy after the third or more artificial insemination. A total of 14 beef cattle and 6 dairy cows that experience repeat breeding in the cattle herd in the Yogyakarta region of Indonesia were used as samples in this study. Cervical and vaginal mucus samples were collected using plastic sheet when the cow was re-estrus. The samples were put into the 5 ml Brain Heart Infusion Broth for bacterial isolation and identification. Pregnancy examination was carried out on day 45 after artificial insemination using ultrasound method. Bacteria that could be isolated and identified from cervical mucus and vaginal mucus of beef cattle and dairy cows included Bacillus sp., Staphylococcus epidermidis, Staphylococcus aureus, and Pseudomonas sp. Some cows detected positive in pregnancy examination even though the bacteria were presence in the cervical and/or vaginal mucus. There was various composition of bacteria found in the cervical mucus and vaginal mucus, of beef cattle and dairy cows with repeat breeding in livestock groups in Yogyakarta. The presence of bacterial in the cervical and vaginal mucus during estrus was not always become the causes of failed pregnancy.","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78033766","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Ambar Retnowati, Agustina Indrawati, U. K. Hadi, Safika ., P. S. Wibowo, S. M. Noor
Leptospirosis is a zoonotic disease caused by bacteria Leptospira sp. which causes infection in animals and humans. Dogs infected with leptospirosis showed symptoms such as anorexia, fever, vomiting, weakness, diarrhea and often experience yellowing of the eye area and mucosa around the mouth (icteric) with fatal systemic complications and multi-organ dysfunction, especially in the kidneys and liver. Leptospirosis is an endemic disease in Jakarta. This study aims to identify risk factors that can contribute to canine mortality based on early clinical symptoms that are found when the dog is in an animal health service facility such as a veterinary clinic, veterinary hospital or independent practice veterinarian. Method were used in this study is clinical manifestations and laboratory examinations and medical records of dogs with suspected leptospirosis. Criteria inclusion were based on aspects of the clinical symptoms of dogs in and around Jakarta. Analysis data used the chi-square with confidence of interval (CI) 95%. Dogs used during the study had ages for puppies (less than 1 year) totaling 13 or 32.50%, for adult dogs over 1 year amounted to 27 or 67.50%, 80% male dogs and 20% female. with 80% maintenance system not housed by the owner. Risk factors for clinical symptoms such as myalgia, symptomatic vomiting of the pulmonary area or shortness of breath and abdominal pain, conjunctival suffusion, anorexia and diarrhea contributed to the high mortality rate leptospirosis during study in dogs 2020.
{"title":"Faktor Risiko Potensial terhadap Canine Leptospirosis di Ragunan Animal Hospital Jakarta, Indonesia","authors":"Ambar Retnowati, Agustina Indrawati, U. K. Hadi, Safika ., P. S. Wibowo, S. M. Noor","doi":"10.22146/jsv.60354","DOIUrl":"https://doi.org/10.22146/jsv.60354","url":null,"abstract":"Leptospirosis is a zoonotic disease caused by bacteria Leptospira sp. which causes infection in animals and humans. Dogs infected with leptospirosis showed symptoms such as anorexia, fever, vomiting, weakness, diarrhea and often experience yellowing of the eye area and mucosa around the mouth (icteric) with fatal systemic complications and multi-organ dysfunction, especially in the kidneys and liver. Leptospirosis is an endemic disease in Jakarta. This study aims to identify risk factors that can contribute to canine mortality based on early clinical symptoms that are found when the dog is in an animal health service facility such as a veterinary clinic, veterinary hospital or independent practice veterinarian. Method were used in this study is clinical manifestations and laboratory examinations and medical records of dogs with suspected leptospirosis. Criteria inclusion were based on aspects of the clinical symptoms of dogs in and around Jakarta. Analysis data used the chi-square with confidence of interval (CI) 95%. Dogs used during the study had ages for puppies (less than 1 year) totaling 13 or 32.50%, for adult dogs over 1 year amounted to 27 or 67.50%, 80% male dogs and 20% female. with 80% maintenance system not housed by the owner. Risk factors for clinical symptoms such as myalgia, symptomatic vomiting of the pulmonary area or shortness of breath and abdominal pain, conjunctival suffusion, anorexia and diarrhea contributed to the high mortality rate leptospirosis during study in dogs 2020.","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"91215346","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Tazkia Annisa, Agung Janika Sitasiwi, Sri Isdadiyanto, Siti Nur Jannah
Diabetes mellitus is a metabolic disease that occurs due to impaired insulin secretion caused by progressive damage to beta cells. Pineapple skin vinegar contained acetic acid and antioxidants which have the potential to help repaired the structure of the nephron ren and other organs affected by diabetes. The purpose of this study was to examined the effectiveness of pineapple skin vinegar on improved the histological structure of diabetic rats ( Rattus norvegicus L.). This study based on changed in the structure of the nephron in samples of normal and alloxan-induced mice pre-treatmented and post-treatmented. Twenty-four rats were divided into 6 groups, named normal control, positive control (diabetes + 0.4 mL apple vinegar), negative control (diabetes + water), dose test groups 1, 2, and 3 (pineapple vinegar 0.2 mL; 0.4 mL; 0.8 mL). Statistical analysis test used ANOVA was followed by Duncan test. The conclusion of this research, the pineapple skin vinegar showed the ability to repair the histopathological structure of white rats damaged by diabetes. The optimum dose needed was 0.8 mL to improved the histological structure of the nephron, as indicated by the glomerular diameter and the distance of the Bowman's capsule space to near normal.
{"title":"Studi Histopatologi Ren Tikus Putih (Rattus Norvegicus L.) Diabetes Setelah Pemberian Cuka dari Kulit Nanas (Ananas Comosus (L.) Mer.)","authors":"Tazkia Annisa, Agung Janika Sitasiwi, Sri Isdadiyanto, Siti Nur Jannah","doi":"10.22146/jsv.56891","DOIUrl":"https://doi.org/10.22146/jsv.56891","url":null,"abstract":"Diabetes mellitus is a metabolic disease that occurs due to impaired insulin secretion caused by progressive damage to beta cells. Pineapple skin vinegar contained acetic acid and antioxidants which have the potential to help repaired the structure of the nephron ren and other organs affected by diabetes. The purpose of this study was to examined the effectiveness of pineapple skin vinegar on improved the histological structure of diabetic rats ( Rattus norvegicus L.). This study based on changed in the structure of the nephron in samples of normal and alloxan-induced mice pre-treatmented and post-treatmented. Twenty-four rats were divided into 6 groups, named normal control, positive control (diabetes + 0.4 mL apple vinegar), negative control (diabetes + water), dose test groups 1, 2, and 3 (pineapple vinegar 0.2 mL; 0.4 mL; 0.8 mL). Statistical analysis test used ANOVA was followed by Duncan test. The conclusion of this research, the pineapple skin vinegar showed the ability to repair the histopathological structure of white rats damaged by diabetes. The optimum dose needed was 0.8 mL to improved the histological structure of the nephron, as indicated by the glomerular diameter and the distance of the Bowman's capsule space to near normal.","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"81849963","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Dwitya Citraesti, Wahono Esthi Prasetyaningtyas, Ni Wayan Kurniani Karja
Low-Density Lipoprotein (LDL) extracted from egg yolk (LDL) has recently known can eliminate the adverse effect associated in the use of fresh egg yolk. The role of LDL in liquid preservation at 4°C of ram sperm has not been explored. This research evaluates the effects of substituting egg yolk with LDL in ram sperm preservation at 4 °C on 5 days. The objective of this research was to assess the effects of substituting egg yolk with LDL for use as an extender in sperm preservation at 4°C, as well as on spermatozoa motility, viability, morphology, plasma membrane, and acrosome integrity, for 5 days. The semen was subsequently divided into five and diluted with Tris–fresh egg yolk (K), Tris–LDL5% (LDL5), Tris–LDL10% (LDL10), Tris–LDL15% (LDL15), and Tris–LDL20% (LDL20). The result showed a significant difference between LDL to fresh egg yolk for ram sperm quality (P<0.05). The effectiveness of LDL on sperm quality decreased following by its concentration. Even though up to 20% concentration of LDL, it can not preserve the quality of diluted semen for motility, viability, and plasm membrane integrity.
{"title":"Efektivitas Low Density Lipoprotein (LDL) dari Kuning Telur Ayam terhadap Kualitas Semen Cair Domba","authors":"Dwitya Citraesti, Wahono Esthi Prasetyaningtyas, Ni Wayan Kurniani Karja","doi":"10.22146/jsv.63395","DOIUrl":"https://doi.org/10.22146/jsv.63395","url":null,"abstract":"Low-Density Lipoprotein (LDL) extracted from egg yolk (LDL) has recently known can eliminate the adverse effect associated in the use of fresh egg yolk. The role of LDL in liquid preservation at 4°C of ram sperm has not been explored. This research evaluates the effects of substituting egg yolk with LDL in ram sperm preservation at 4 °C on 5 days. The objective of this research was to assess the effects of substituting egg yolk with LDL for use as an extender in sperm preservation at 4°C, as well as on spermatozoa motility, viability, morphology, plasma membrane, and acrosome integrity, for 5 days. The semen was subsequently divided into five and diluted with Tris–fresh egg yolk (K), Tris–LDL5% (LDL5), Tris–LDL10% (LDL10), Tris–LDL15% (LDL15), and Tris–LDL20% (LDL20). The result showed a significant difference between LDL to fresh egg yolk for ram sperm quality (P<0.05). The effectiveness of LDL on sperm quality decreased following by its concentration. Even though up to 20% concentration of LDL, it can not preserve the quality of diluted semen for motility, viability, and plasm membrane integrity. ","PeriodicalId":17708,"journal":{"name":"Jurnal Sain Veteriner","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75389539","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
京公网安备 11010802042870号
京ICP备2023020795号-1
扫码关注我们
求助内容：
应助结果提醒方式：